ID: 1038449733

View in Genome Browser
Species Human (GRCh38)
Location 8:27632491-27632513
Sequence ACATATATGCAGAAAATGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1038449733_1038449736 10 Left 1038449733 8:27632491-27632513 CCTGCCATTTTCTGCATATATGT No data
Right 1038449736 8:27632524-27632546 ACCATTAGCTCAGACTACATTGG No data
1038449733_1038449738 15 Left 1038449733 8:27632491-27632513 CCTGCCATTTTCTGCATATATGT No data
Right 1038449738 8:27632529-27632551 TAGCTCAGACTACATTGGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1038449733 Original CRISPR ACATATATGCAGAAAATGGC AGG (reversed) Intergenic
No off target data available for this crispr