ID: 1038452801

View in Genome Browser
Species Human (GRCh38)
Location 8:27650730-27650752
Sequence TTGTTGGCATGGAGGAAAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 414
Summary {0: 1, 1: 0, 2: 1, 3: 34, 4: 378}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1038452801_1038452808 8 Left 1038452801 8:27650730-27650752 CCCTCTTTCCTCCATGCCAACAA 0: 1
1: 0
2: 1
3: 34
4: 378
Right 1038452808 8:27650761-27650783 GTGGACCATGACTATTTGTTTGG No data
1038452801_1038452810 16 Left 1038452801 8:27650730-27650752 CCCTCTTTCCTCCATGCCAACAA 0: 1
1: 0
2: 1
3: 34
4: 378
Right 1038452810 8:27650769-27650791 TGACTATTTGTTTGGTTTCCAGG No data
1038452801_1038452811 27 Left 1038452801 8:27650730-27650752 CCCTCTTTCCTCCATGCCAACAA 0: 1
1: 0
2: 1
3: 34
4: 378
Right 1038452811 8:27650780-27650802 TTGGTTTCCAGGAGAACTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1038452801 Original CRISPR TTGTTGGCATGGAGGAAAGA GGG (reversed) Intronic
901393927 1:8966772-8966794 TTGTTGACATGAATGAAACAAGG + Intronic
901816319 1:11795416-11795438 TGGTTGGCATGGATGATGGAAGG - Intronic
902132316 1:14273070-14273092 TTGTTGGGCTGGATGAAACACGG + Intergenic
902358614 1:15928081-15928103 TTTTTGGCAGAGAGGAACGAAGG + Exonic
902997843 1:20240913-20240935 TTGTTGGGATAGAGGCAACATGG + Intergenic
903375919 1:22865933-22865955 TTTTTGCCGTGAAGGAAAGAAGG - Intronic
903651494 1:24925250-24925272 CGGTTGGCAGGGAGGAAGGAGGG - Intronic
904549268 1:31301894-31301916 TTGGTGGGAGGGAGGAAAGTTGG + Intronic
906174996 1:43763453-43763475 TAGTTGGCATGGAGGAGTGGCGG + Intronic
906245566 1:44271081-44271103 TTGTGTGCATGAAGGGAAGAGGG - Intronic
906710652 1:47927361-47927383 TTGTTGGCTTGGAAGGGAGAAGG - Intronic
906869785 1:49465486-49465508 TTGTTGATATGGAGGAGATAGGG - Intronic
907193800 1:52669962-52669984 ATGATGGCATGGAGGAATGTTGG - Intergenic
908982466 1:69975743-69975765 AAGTTGGCATGGTGGAAGGAGGG - Intronic
909074270 1:71034763-71034785 ATCATGGCATGGAGGAAACATGG + Intronic
909969536 1:81964371-81964393 TGGGCGGCAGGGAGGAAAGAGGG - Intronic
910139108 1:84006894-84006916 TTATTCAAATGGAGGAAAGAGGG - Intergenic
910934602 1:92477111-92477133 TTTTTAGCAAGGAGGACAGAGGG - Intronic
911194901 1:94984398-94984420 ATGTTCACATGGAGGCAAGATGG - Intronic
912253952 1:108040069-108040091 TTTTTGTCATGAAGGCAAGAGGG - Intergenic
913417837 1:118631525-118631547 TTGTTTGCAGGGGGGAAAAAGGG + Intergenic
914755493 1:150559602-150559624 TTATAGACTTGGAGGAAAGATGG + Intronic
914772170 1:150697358-150697380 TTGGTGGAAGAGAGGAAAGAGGG + Intergenic
914931955 1:151942850-151942872 TTGTGGCCATATAGGAAAGAGGG - Intergenic
915266517 1:154722059-154722081 TTGTTTGTAGGGAGGGAAGAGGG - Intronic
915320603 1:155054012-155054034 TTTTTGGCTTAGGGGAAAGAGGG + Intronic
915577487 1:156789560-156789582 TTGGGGCCAAGGAGGAAAGAAGG + Intronic
916228453 1:162514596-162514618 TTGTAGGAAGGAAGGAAAGAAGG + Intronic
916740373 1:167642037-167642059 TTGTTGTCATGGCAGAAGGAAGG + Intronic
917215454 1:172673738-172673760 TTGGTGGCATGGAGGCAATAGGG - Intergenic
917485156 1:175448861-175448883 TTTTTGGCATGGAGGGAAGCAGG - Intronic
917672488 1:177286106-177286128 GTGTGGGGATGGAGGAGAGAAGG + Intergenic
918221855 1:182442643-182442665 TTGCTGGAATTGAGGAGAGAGGG - Intergenic
918824223 1:189301034-189301056 GGGTGGGCCTGGAGGAAAGAAGG - Intergenic
919820318 1:201468367-201468389 TGGGTAGCATGAAGGAAAGATGG + Exonic
921029535 1:211325625-211325647 TTGTGGTCATGGAGAAAGGAGGG - Intergenic
922275451 1:224073550-224073572 TTGTTGCCTCTGAGGAAAGAAGG + Intergenic
922560348 1:226565080-226565102 TGGTAGGCATGGAGGAAAGGAGG + Intronic
922910688 1:229213697-229213719 CTGTGGGCAAGGAGGAAAGAAGG + Intergenic
923369338 1:233295274-233295296 CTGTGGGTATGGAGGGAAGAAGG - Intronic
1062941997 10:1429121-1429143 TTGTTATCATGGAGGGAAGCCGG + Intronic
1062963560 10:1591320-1591342 TTTTTGAGAGGGAGGAAAGAAGG - Intronic
1063459337 10:6205283-6205305 TTACTGGAATGGAGGGAAGAAGG + Intronic
1064474639 10:15674243-15674265 TATGTGGGATGGAGGAAAGAGGG - Intronic
1066534970 10:36381365-36381387 TTGTTGTCATCGGGGAAAGGAGG + Intergenic
1066642697 10:37571879-37571901 TTGTTGTCATCGGGGAAAGGAGG + Intergenic
1066725314 10:38385931-38385953 TTGTGGGGATGGAAGACAGAGGG - Intergenic
1067511754 10:46901360-46901382 TTTATGGCAGGGAGGAAGGATGG - Intergenic
1067650493 10:48150464-48150486 TTTATGGCAGGGAGGAAGGATGG + Intergenic
1068506231 10:57902973-57902995 TTGTTGGCAGGAAGGTAAGATGG + Intergenic
1068633237 10:59320156-59320178 TTGTTGCCTTGGAGGAATGTAGG + Intronic
1069144600 10:64874420-64874442 TTGTTGGCATGGTGGAGAGATGG + Intergenic
1069882455 10:71602259-71602281 TAGTGTTCATGGAGGAAAGATGG + Intronic
1072568379 10:96637264-96637286 TTAATGGGATGGAAGAAAGAGGG + Intronic
1072659703 10:97356259-97356281 TTGTTGGTCTGGAGCAGAGAAGG - Intergenic
1072975523 10:100054205-100054227 TGGGGGGGATGGAGGAAAGAAGG - Intronic
1073055696 10:100699544-100699566 TTGCTGGCTTGGAAGACAGAGGG + Intergenic
1073560208 10:104489775-104489797 TTGTTGACACAGAGGAAGGAGGG + Intergenic
1073583316 10:104686687-104686709 TTGATGACAAGGAGGGAAGAGGG - Intronic
1073894490 10:108139130-108139152 TTGTGGGCATGGAGTTAGGAAGG - Intergenic
1074022763 10:109601382-109601404 TTTCTGGCATGTAAGAAAGAAGG + Intergenic
1076010919 10:126987505-126987527 ATGTTGCCTGGGAGGAAAGAAGG - Exonic
1077350909 11:2092807-2092829 TGGTTGGGGTGTAGGAAAGAGGG - Intergenic
1077468426 11:2745129-2745151 AAGTTGGCATGGAGGAATAAAGG - Intronic
1078651392 11:13197158-13197180 TTCTAGGCATGGAGCAGAGAGGG - Intergenic
1078930887 11:15911373-15911395 TTGGAGCCATGGAGGGAAGAAGG + Intergenic
1078935179 11:15943260-15943282 TTGGTGACAGAGAGGAAAGAGGG + Intergenic
1080478475 11:32620859-32620881 TTGTTGGCATATAGGAATGCTGG - Intronic
1082189964 11:49231193-49231215 ATGGTGGGAGGGAGGAAAGAAGG + Intergenic
1082909477 11:58354075-58354097 TTATTGACATGAAGGAAGGAGGG - Intergenic
1085021491 11:73213008-73213030 CTGTGGGCATGGAGGAAAGCTGG + Intergenic
1085437072 11:76515701-76515723 ATGTTGGCATTGAGCAAATAAGG - Intronic
1085534809 11:77211498-77211520 TCCTTGGCATGGAGGACTGAAGG - Intronic
1086676564 11:89615349-89615371 ATGGTGGGAGGGAGGAAAGAAGG - Intergenic
1086913199 11:92496700-92496722 TTGTTGGGTTGAAGGAAGGAAGG + Intronic
1087220310 11:95539990-95540012 TTGTTGGCATGGAAGTATGTGGG - Intergenic
1088355986 11:108944321-108944343 TTGCTGGAATGCAGGAAGGAGGG + Intergenic
1090162385 11:124509626-124509648 GTGGTTGCTTGGAGGAAAGAAGG + Intergenic
1092953588 12:13529693-13529715 TTGTTGGAAGGAAGGAAAGGAGG + Intergenic
1093090311 12:14913093-14913115 TTGTGAGTATGGGGGAAAGATGG + Intergenic
1093709536 12:22314205-22314227 TAGTGAGCATGGAGGAAGGAGGG - Intronic
1094161968 12:27400594-27400616 TTGTTGGAATGGAAGAAGAAAGG + Exonic
1094238323 12:28193152-28193174 TTTTTGGCATTTAGGAATGAAGG + Intronic
1094298089 12:28930414-28930436 TTGTAGGTATAGAGGAAACAAGG + Intergenic
1094406822 12:30125161-30125183 TTGTTGGAATGGAAGAATGCTGG + Intergenic
1094492976 12:30972775-30972797 TTCTTGGCAAAGAGGAAAGCCGG + Intronic
1095159069 12:38894414-38894436 TTGTAGGCATTGGGGAAAGGAGG - Intronic
1096052062 12:48619003-48619025 ATGTTCTCATGGAAGAAAGAGGG + Intergenic
1098337814 12:69421786-69421808 TTGTTGCCATGTAGAAAAGGTGG + Intergenic
1098781299 12:74690174-74690196 TTGTGGGCAAGGATGAAGGAGGG - Intergenic
1099089557 12:78288145-78288167 ATTTTGGCATGAAAGAAAGAAGG + Intergenic
1099281660 12:80656466-80656488 TTGTTTTCAAGGAGGAAAAATGG - Intronic
1100328525 12:93564776-93564798 TTGTAGGCACTGAGGATAGAGGG + Intergenic
1100715974 12:97306121-97306143 ATGATGGCAGAGAGGAAAGAAGG - Intergenic
1101348527 12:103907058-103907080 CTGTTGGAAGGGAGGAAGGAAGG + Intergenic
1101506607 12:105352631-105352653 TTTTTGGCATGGAGGAGGCATGG + Intronic
1101541215 12:105667161-105667183 TTGTTGGATTGGAAGAAAGTGGG - Intergenic
1102164847 12:110797892-110797914 ATGTGGGCATGGATGGAAGAGGG - Intergenic
1103052357 12:117791158-117791180 TGGTGGGCATAAAGGAAAGAAGG - Intronic
1104510010 12:129368711-129368733 CTGTTGGTAAGGAGGAAAGAGGG - Intronic
1105612094 13:21977629-21977651 TTGAGGGCATAGCGGAAAGAGGG + Intergenic
1105733847 13:23247296-23247318 TCGTTGGCATGGAGTAAACCAGG + Intronic
1106442088 13:29784493-29784515 TTGTTGCCATTTAGCAAAGAAGG - Intronic
1106777158 13:33019582-33019604 TTGATGGCCTGGAGGACAGGAGG + Intronic
1107448964 13:40491630-40491652 ATGTTTGCAGGGAGGCAAGAAGG + Intergenic
1109132335 13:58602816-58602838 TTGATGGGGTGGATGAAAGATGG + Intergenic
1109612139 13:64779961-64779983 TTGGTGGCATTGATGAAATAAGG - Intergenic
1109808441 13:67475343-67475365 CTCTTGGCATGGAGCAGAGAAGG + Intergenic
1110064210 13:71082532-71082554 TTGGTGTCTTGGAGGAAAGCAGG - Intergenic
1110215658 13:73021832-73021854 TTTTTTGAAAGGAGGAAAGAGGG + Intergenic
1110524867 13:76524600-76524622 TTGTTGGCAAAGGGGAGAGAGGG - Intergenic
1111331450 13:86764656-86764678 TTGTTGGGGAGGAGGAAAGCGGG + Intergenic
1111809826 13:93085983-93086005 TTGTTGGTAGGGATGTAAGATGG + Intergenic
1111933395 13:94534880-94534902 TGGATGGCATTGGGGAAAGATGG - Intergenic
1112745051 13:102518106-102518128 TAGTTGTCAGGGGGGAAAGATGG - Intergenic
1113808894 13:113125740-113125762 TTGAGGGAATGAAGGAAAGATGG - Intronic
1113877666 13:113604744-113604766 TGGTTGGCCTGGAACAAAGAGGG - Intronic
1117402793 14:55372717-55372739 TTGGAGGGAGGGAGGAAAGAAGG - Intronic
1118291936 14:64534802-64534824 ATGTTGGCCTGAAGAAAAGATGG - Intergenic
1118988888 14:70780262-70780284 TTGTTGGGCTGGAGGATAGAAGG + Intronic
1119460812 14:74801727-74801749 TTGTTGGCATGTGGGAATGTAGG + Intronic
1120179070 14:81324833-81324855 TTGTTGGTTTGGAGGAAGCATGG + Intronic
1120252328 14:82073477-82073499 TTCTGGGCATGGAGCAAAAAAGG - Intergenic
1121684861 14:95828161-95828183 ATGCTGGGGTGGAGGAAAGAAGG + Intergenic
1124107295 15:26751914-26751936 TGCTTGGCAAGGAGGAAACATGG + Intronic
1124462802 15:29908532-29908554 TTGTTAGCAAGGAAGAATGAGGG - Intronic
1124691165 15:31824370-31824392 TTGTGGGCATGGAGGATACCTGG - Intronic
1124905610 15:33865516-33865538 TTGTTGGGATGGAAGCATGAAGG + Exonic
1125287585 15:38110454-38110476 TTGCTGGCTTGGAAGATAGAGGG + Intergenic
1125499661 15:40231567-40231589 TTGTTGGGAAGGAGAAAGGAAGG + Intergenic
1126069231 15:44851253-44851275 CTGTTGACAATGAGGAAAGAAGG - Intergenic
1127930238 15:63591506-63591528 TTGTTTGCGGGGAGGTAAGATGG + Intronic
1128530860 15:68446603-68446625 CTGTTGGGAAGGAAGAAAGAAGG + Intergenic
1128890546 15:71328021-71328043 CTATTGTAATGGAGGAAAGAAGG - Intronic
1129084096 15:73070032-73070054 ATGTTGGCATGGGGAAAACAAGG + Intronic
1129128531 15:73467959-73467981 TTGCTGGCATTGAGGATGGAAGG - Intronic
1131307966 15:91262181-91262203 TTTTTCTCATGGAGAAAAGAGGG + Intronic
1131380333 15:91958391-91958413 TTGATGTCATGGAGCAAAGATGG + Intronic
1131543803 15:93298969-93298991 TAGTTGGCAGGCAGGAAAGCGGG + Intergenic
1132404456 15:101533757-101533779 TTGGTGGAAGGAAGGAAAGAAGG + Intergenic
1133704430 16:8340003-8340025 TTGTGGGCATAGAAGAGAGAGGG - Intergenic
1133851314 16:9506511-9506533 TAGTTGGCATGGATGAAAATGGG + Intergenic
1133927457 16:10204771-10204793 TTGTTGGCTTGTTGTAAAGAGGG + Intergenic
1134453015 16:14374813-14374835 TTGGGGTCATGGAGGGAAGAAGG + Intergenic
1135166817 16:20146464-20146486 TTCTTGGGAAGAAGGAAAGAAGG + Intergenic
1137614026 16:49836367-49836389 GGGTTGGCATGGAGGGAAGGGGG + Intronic
1137641216 16:50031857-50031879 GTGTTGCCATGGAGGGAGGAAGG + Intronic
1139347836 16:66315866-66315888 CTTTTGCCATGGAGGTAAGAGGG + Intergenic
1140187033 16:72783642-72783664 TTGGAAGGATGGAGGAAAGATGG + Exonic
1143668056 17:8376016-8376038 TTGTTGAGATGAAGGAGAGATGG - Exonic
1144044307 17:11441098-11441120 TTGAAGTCATGGAGGGAAGAAGG - Intronic
1144366236 17:14547535-14547557 GTGGTGACATGGAGGAAAGTTGG + Intergenic
1144632635 17:16881876-16881898 TGGATGGCCTGGAGGACAGAGGG - Intergenic
1146151328 17:30475258-30475280 TTGATGGCAAGGAGTGAAGATGG - Intergenic
1146894865 17:36534200-36534222 TTCTAGGCATGGAGGACAGTGGG + Intronic
1149595141 17:57860897-57860919 TTGTTGTCAGGGAAGAGAGAGGG + Intergenic
1150573172 17:66405934-66405956 TGGTTGGTGTGGAGGAAAAATGG + Intronic
1153393978 18:4596744-4596766 TGATTTGCCTGGAGGAAAGAAGG + Intergenic
1153422343 18:4921154-4921176 TTGTTGGCAGGGATGTAAAATGG + Intergenic
1157312762 18:46564613-46564635 TTGTTGGCATTGAAGAAGGGGGG + Intronic
1158019830 18:52828367-52828389 TTGGTGGCATGCAGTTAAGAGGG - Intronic
1158341097 18:56467202-56467224 TCCTTGGCATGAAGGAAAGAAGG + Intergenic
1158805972 18:60973386-60973408 TTTATGGGATGGAGGAAATAGGG - Intergenic
1159018331 18:63121406-63121428 TTCTGGGGATGGAGGAGAGAGGG - Intergenic
1159903733 18:74072001-74072023 ATGTTGGGATGGAGGAGGGAAGG - Intergenic
1161850439 19:6735455-6735477 TTGTTGGAAGGAAGGAGAGAGGG - Intronic
1164628128 19:29742979-29743001 GTGTTGGCATGAAGGAAACTTGG + Intergenic
1164785486 19:30927118-30927140 ATGTTGGCATGAAGGAAGCAGGG - Intergenic
1165283568 19:34818023-34818045 TTTTGGGCCTGGAGGAAAAAAGG + Intergenic
1168481023 19:56719693-56719715 CTGCTGGGATGGAGGAAAGATGG + Intergenic
925474699 2:4200073-4200095 TTTTGGGTATGGAGGAAAGTGGG + Intergenic
926790796 2:16569407-16569429 TTCTAAGCCTGGAGGAAAGATGG - Intronic
927332341 2:21880294-21880316 TTGTGGGAATGTAGGAAATATGG - Intergenic
927757013 2:25716844-25716866 CTCCTGACATGGAGGAAAGAAGG - Intergenic
927908637 2:26880630-26880652 TCTCTGGCATGGAGAAAAGAGGG - Intronic
927928536 2:27029270-27029292 TTGTTGGCTTTGAAGACAGAAGG + Intergenic
928216063 2:29362290-29362312 TTGTTGGCAGGAAAGAAAGAAGG - Intronic
928419171 2:31124207-31124229 CAGTTGGCAAGCAGGAAAGATGG - Intronic
929537025 2:42790154-42790176 TGGGAGGCATGGAGGCAAGACGG + Intronic
929824288 2:45298338-45298360 TTGGTTGCCTGGAGGACAGAGGG + Intergenic
930110936 2:47677988-47678010 TGGGTGGCACAGAGGAAAGAGGG - Intergenic
930175204 2:48294545-48294567 AGGTTGGCATGGAGCAAAAATGG - Intergenic
930195781 2:48508531-48508553 TTGTTGGAATGCAGGAAAGGGGG + Intronic
930779301 2:55207524-55207546 TTGTTGGTATGGTAAAAAGAAGG - Intronic
931208202 2:60167852-60167874 TAGTTGGAAGGTAGGAAAGAGGG + Intergenic
931208378 2:60169341-60169363 TTGAATGTATGGAGGAAAGAAGG - Intergenic
931632670 2:64315520-64315542 GAGTTGGCCAGGAGGAAAGATGG + Intergenic
934985715 2:98883316-98883338 TTGTTGGCATGGAGGAACAGTGG + Intronic
935639239 2:105275072-105275094 TTGTGGGCCTGGAGGAGGGAGGG - Intronic
937339843 2:121084159-121084181 TTGTTGGCATGACAGAGAGATGG - Intergenic
937390770 2:121484453-121484475 TTTTTGGCATGCAGGACAAAGGG - Intronic
937400867 2:121582472-121582494 TTTTTGGAAGGAAGGAAAGAAGG + Intronic
937981663 2:127619418-127619440 TGGTTGGATTGGAGGAATGAAGG + Intronic
937996664 2:127699284-127699306 TTGCTGGCACGGTGGAACGAAGG + Intergenic
938655817 2:133432438-133432460 TGGGTGGCATGGAGGAAGGAAGG - Intronic
938913520 2:135909583-135909605 TTGTTGGAATGGGGAGAAGATGG - Intronic
938939901 2:136161054-136161076 TGATTGGCGTGGAGGGAAGATGG + Intergenic
939848337 2:147274644-147274666 TTGTTGGCATGAGAGAAAAAAGG - Intergenic
940219623 2:151338138-151338160 TTGTTGGAGTGGAGGAGAAAAGG + Intergenic
940922818 2:159328558-159328580 TTGTTGCCATGTAGGAATGTGGG - Intronic
941268960 2:163401277-163401299 GTGTTGGTATGGAGGGTAGAAGG - Intergenic
942046996 2:172105438-172105460 TTGTGTACATGGGGGAAAGAGGG + Intergenic
942290793 2:174468109-174468131 CAGTTGGCAATGAGGAAAGAAGG - Intronic
942518416 2:176777518-176777540 TTGTTGCCTTGCAGGAATGAAGG + Intergenic
942897583 2:181076118-181076140 CTGTTGGCCTGGAGGAAACATGG - Intronic
943890480 2:193279662-193279684 TTGTTGGAAGGAAGGAAGGAAGG - Intergenic
945145072 2:206729360-206729382 TTGTTGGAATTTAGAAAAGAGGG + Intergenic
946491857 2:220156341-220156363 TTGTTGGGTTGGAGGAAAAAAGG - Intergenic
946988000 2:225295518-225295540 TAGTGGGCATGGAGAAGAGATGG - Intergenic
948312279 2:236997013-236997035 TTGTTTGCATGGTGGAATTATGG + Intergenic
948608645 2:239152757-239152779 CTGTAGGCATGGAGGCAAGGAGG + Intronic
1169682623 20:8232766-8232788 GTTTTGGACTGGAGGAAAGATGG + Intronic
1170047710 20:12103366-12103388 TTATAGGCATGGAGGAAGGGAGG + Intergenic
1170463631 20:16602297-16602319 TAGTTGGAAAGGAGGAGAGATGG + Intergenic
1170933885 20:20793250-20793272 TTGTTGGCAGAGAGAAAAGCGGG + Intergenic
1172164705 20:32892083-32892105 TGGTTGCCATGGGGGAAAAAGGG + Intronic
1172438610 20:34948950-34948972 TTGTTGCCATGCAGGAAAGTAGG + Intronic
1173681956 20:44888905-44888927 TTGTTGGCAGGGAGGAAATGAGG + Intronic
1173950064 20:46985226-46985248 TTGGAGGAAGGGAGGAAAGAAGG - Intronic
1175461528 20:59155302-59155324 TTGTTAGCAGGCAGGAAAGCAGG + Intergenic
1178267033 21:31152994-31153016 TTGTTGGTAAAGAGGAAAAATGG - Intronic
1178422127 21:32451402-32451424 TTCTCGGCAAGGAGGAAGGAAGG - Intronic
1181161164 22:20960748-20960770 GTGTGGGCAAGGAGGTAAGATGG - Intergenic
1181495369 22:23284521-23284543 AGGTTGGAATGGAGCAAAGAGGG + Intronic
1181891027 22:26063634-26063656 TTGTTGGGATGGCTGAAAAATGG - Intergenic
1181961013 22:26621912-26621934 TTATAGGCAGGGAGGGAAGAGGG - Intergenic
1182451216 22:30423093-30423115 TTGTTTGCATGGAGAACAGCGGG - Exonic
1183359582 22:37376527-37376549 CTTTGGGCATGGAGGAAAGGAGG - Intronic
1184096712 22:42320016-42320038 TGGTGGGAATGGAGGGAAGATGG - Intronic
949507622 3:4741970-4741992 CTGTTGGCATTAAAGAAAGAGGG + Intronic
952000767 3:28783291-28783313 CTTTTGTCATGGAGAAAAGAAGG + Intergenic
952443627 3:33358527-33358549 TTGTTTGCCTGGCAGAAAGATGG - Intronic
953375433 3:42424224-42424246 TTGTTGGCATGAAGAAGTGAAGG + Intergenic
954150517 3:48654925-48654947 TTGGTGGTTTGGGGGAAAGATGG + Intronic
954596838 3:51832035-51832057 TTGTTGCCCTAGAGGATAGAAGG - Intergenic
954757262 3:52847904-52847926 TTGTTGGCTTGGACGACGGAAGG + Intronic
955718047 3:61851568-61851590 TTATTTGCATGGTGGAAAAATGG + Intronic
956327269 3:68067762-68067784 TTGTTGAATTGAAGGAAAGAGGG - Intronic
956433761 3:69213253-69213275 TGGTTGTCATGGAGGAAAAATGG + Intronic
956761648 3:72448958-72448980 TTGTTCTAATGGTGGAAAGAGGG - Intergenic
957048501 3:75394642-75394664 TTATCGGCAAGGAGGAAGGAAGG + Intergenic
959212555 3:103406178-103406200 TTATTGGCAAGATGGAAAGAAGG + Intergenic
959459841 3:106612173-106612195 TTATTGTTTTGGAGGAAAGAAGG - Intergenic
960015738 3:112885600-112885622 TTGTTGGTTTACAGGAAAGAGGG + Intergenic
961325887 3:126109141-126109163 TTGATGGCATGAAGGAGGGAAGG - Intronic
961880582 3:130058755-130058777 TTCTCGGCAAGGAGGAAGGAAGG + Intergenic
962752055 3:138440779-138440801 TGTTGGGCTTGGAGGAAAGAGGG - Intronic
963638320 3:147826888-147826910 TTGGTGGTATGGAGTAAGGATGG - Intergenic
964225071 3:154389197-154389219 TTGTTTCCATTGAGGAAAGATGG - Intronic
965085412 3:164089550-164089572 TAGTTTTCATAGAGGAAAGAAGG - Intergenic
965505165 3:169507406-169507428 AGATTGGCATGGAGGAATGAAGG - Intronic
966406190 3:179600799-179600821 TTGTTGCCATGTAGGAATGCAGG + Intronic
966424290 3:179764470-179764492 TTGTGGCCCTAGAGGAAAGAGGG + Intronic
968992975 4:3927099-3927121 TTCTCGGCAAGGAGGAAGGAAGG + Intergenic
969242133 4:5906209-5906231 ATGTTGGCATGGAGAGAAGTGGG + Intronic
970613959 4:17750786-17750808 TTGTTGGCAAGGAAGAAGGAAGG - Intronic
970883182 4:20955911-20955933 TTATTGGAATGGAATAAAGAAGG + Intronic
971821909 4:31568110-31568132 TTTTTGGCATAGAGGAAAATGGG - Intergenic
971828453 4:31659083-31659105 TTGTTAGCCAGGAGGACAGAAGG + Intergenic
972125634 4:35761298-35761320 TAGTTGGAGTGGAGGAAGGAGGG - Intergenic
973737820 4:53889747-53889769 TGGTAGGCAGGGAGGAGAGAGGG + Intronic
974022976 4:56707978-56708000 TTGTAGGAATGAAGGAAAGGAGG + Intergenic
974175735 4:58320399-58320421 TTGTTGGCATAAAGAAAAAAAGG + Intergenic
974189954 4:58491860-58491882 TTGTTTGCATGCAGTAAAGCAGG - Intergenic
974483267 4:62473397-62473419 TTGATGGCAGGAAGGAAGGAAGG - Intergenic
975555994 4:75665203-75665225 TTGTTGGAAAGGAAGAAACAAGG - Intronic
975877699 4:78863613-78863635 GTGATGGCAAGGAGAAAAGAAGG + Intronic
976454646 4:85232205-85232227 TTCTTGGAAGGAAGGAAAGAAGG - Intergenic
976553399 4:86422465-86422487 TTGTTGGCATAATGGAATGAAGG - Intronic
976697137 4:87928774-87928796 TGGTTGGCGGGGAGGAGAGATGG + Intergenic
977155966 4:93574149-93574171 TTTGTGCCTTGGAGGAAAGATGG - Intronic
977687181 4:99860270-99860292 TTGTTTGGGTGGAGGTAAGATGG + Intronic
977791793 4:101113506-101113528 TTGATGGCATCTAGGAAGGAGGG + Intronic
977873015 4:102115606-102115628 TAGTTGGCAAAGAGGAAAGTGGG + Intergenic
978653299 4:111034889-111034911 TCTTTGGCATTGAGAAAAGAGGG + Intergenic
979300627 4:119082316-119082338 TTGATGGCCTGGAGGAAGGTCGG - Intergenic
979645916 4:123068627-123068649 TTGTTGGCAGGTATGAATGAGGG - Intronic
980272030 4:130596644-130596666 TTGTTGCCTTTGGGGAAAGAAGG + Intergenic
980991971 4:139745858-139745880 TCCTGGGGATGGAGGAAAGATGG + Intronic
982297423 4:153844070-153844092 TGGGTGGCATGGAAGGAAGAGGG + Intergenic
985124799 4:186682777-186682799 CTGATGACATGGAGAAAAGAAGG - Intronic
986137527 5:4995638-4995660 TTGCTGGTATGGATGTAAGATGG - Intergenic
986221861 5:5775543-5775565 GTGTGGGCCTGGAGGTAAGAGGG + Intergenic
987476878 5:18401479-18401501 TTTTTGGCCTGGAGGCAAGAGGG - Intergenic
987938460 5:24501037-24501059 TTGTTGCTATGGAGAAAAGTGGG + Intronic
988081102 5:26416384-26416406 TTGCTGGCAATGAGGAGAGAAGG - Intergenic
988101015 5:26678686-26678708 TTGATGGCATGTAGGCAAAAAGG + Intergenic
988640645 5:33037620-33037642 GTGGTAGCATGGAGGAGAGAGGG - Intergenic
988678391 5:33458065-33458087 ATGTTGGCAAGGAGGTAGGAGGG + Intronic
989135024 5:38145003-38145025 TGGTAGGCATGATGGAAAGAAGG + Intergenic
989209701 5:38846533-38846555 GTGTTGGGAGAGAGGAAAGAGGG - Intronic
989304559 5:39938391-39938413 GTGGTGGCATGGTGGGAAGAGGG - Intergenic
990659888 5:58001587-58001609 ATGTTAGCAGGGAGAAAAGATGG - Intergenic
992481061 5:77152888-77152910 TTATTTGCATGGAGGAAGAAGGG + Intergenic
992487072 5:77207946-77207968 TTGTTGGAATAGAAGATAGAAGG - Intergenic
994236483 5:97369147-97369169 TTCTTGGCATGGAGGACAAGTGG + Intergenic
994697735 5:103093363-103093385 TTGTTGGCTTTGAAGATAGAGGG + Intronic
994736077 5:103558168-103558190 TAGTAGAAATGGAGGAAAGAGGG - Intronic
994935691 5:106250606-106250628 TTGTTGGCATGCAGCAGAGGTGG - Intergenic
995050656 5:107699038-107699060 CTGTTGCCATGGAGGAATGCTGG + Intergenic
997033574 5:130160330-130160352 TAGTGGGCAAGGAGGAAAGCAGG - Intronic
997223499 5:132191094-132191116 GTGTTCGCATGGCAGAAAGAGGG + Intergenic
997262837 5:132477327-132477349 TTGTTGCTTTGAAGGAAAGAAGG + Intergenic
997383048 5:133450998-133451020 ATGATGGGAGGGAGGAAAGAAGG + Intronic
997943849 5:138182122-138182144 TTGTTGATTTGGTGGAAAGATGG + Intronic
998924727 5:147109689-147109711 TTGTTGCCATGGAGGGAACTGGG + Intergenic
998984955 5:147746337-147746359 TTGTACTCATGGACGAAAGACGG + Intronic
999333467 5:150694472-150694494 TTTTTCCCATGGAGGAAAGGGGG + Intronic
999445426 5:151634948-151634970 TTATTGTGATGAAGGAAAGAAGG + Intergenic
999643698 5:153697678-153697700 TAGTAGACATGGGGGAAAGAGGG + Intronic
1000841011 5:166218422-166218444 TAGTTGTCATGCAGAAAAGACGG - Intergenic
1001330352 5:170757976-170757998 TCTCTGGCATGGAAGAAAGAAGG + Intergenic
1001894244 5:175364743-175364765 TGGTTGCCAGGGAGGGAAGAGGG - Intergenic
1001919151 5:175586998-175587020 GTCTTGACAGGGAGGAAAGATGG + Intergenic
1002309077 5:178303729-178303751 TTGATGGGAAGGAGGAGAGAAGG - Intronic
1002616691 5:180460700-180460722 TGGGTGTCATGGAGGAAAGGAGG + Intergenic
1003958272 6:11186388-11186410 TTGGTAGCAATGAGGAAAGAAGG - Intronic
1004129010 6:12901431-12901453 TTGGAGGAAAGGAGGAAAGAGGG + Intronic
1004333773 6:14745192-14745214 TTTTTGGCATGCAGTAATGAAGG - Intergenic
1007624173 6:43233615-43233637 GTGATGGGATGGAGGAATGAGGG + Intergenic
1008072231 6:47109436-47109458 TTGGTGGAAGGGAGGAATGAGGG + Intergenic
1009928042 6:70143933-70143955 TTATTGCCATCGAGGAAGGATGG - Intronic
1010511392 6:76724701-76724723 TTCTTGGCATGAAAGAAGGAAGG - Intergenic
1011290510 6:85772229-85772251 GTGTTTGCATGGAGGCAGGACGG + Intergenic
1011382973 6:86762493-86762515 AGGTGGGCAAGGAGGAAAGAGGG - Intergenic
1012429035 6:99144862-99144884 ATGTTGGCATGGTGGGGAGATGG + Intergenic
1013591457 6:111622471-111622493 CTGTGGGTATGGTGGAAAGAAGG + Intergenic
1013773162 6:113650028-113650050 TGGTTGGTCTGGAGGAAAAAGGG - Intergenic
1013782610 6:113745920-113745942 TGGTTGGCATTGAGGAAATTTGG - Intergenic
1015121763 6:129708168-129708190 TTGAGGGCAGGGAGGAAGGAGGG - Intronic
1015897869 6:138034597-138034619 TTGTTGGCCTAGAGGAATTAGGG - Intergenic
1016140603 6:140605453-140605475 ATTTTGGAATGGAGCAAAGATGG - Intergenic
1017475340 6:154785533-154785555 ATGGTGGCATGTAAGAAAGATGG - Intronic
1017489807 6:154935020-154935042 TTGTTGGAATGTAGGAAAAAGGG + Intronic
1017864179 6:158428269-158428291 TTCTGGGCATTGAAGAAAGAGGG + Intronic
1017951469 6:159138483-159138505 AGTTTGGCATAGAGGAAAGAGGG + Intergenic
1018453062 6:163926826-163926848 CTGTTGGCTGGGAGGAAACATGG + Intergenic
1020034050 7:4953135-4953157 CTGTAGGGATGGAGGAAACAGGG - Intronic
1020315608 7:6903444-6903466 TTCTCGGCAAGGAGGAAGGAAGG + Intergenic
1020883293 7:13791364-13791386 CTGTAGGCAGGCAGGAAAGAGGG - Intergenic
1021089880 7:16471176-16471198 TTGGTGAGATGGAGCAAAGATGG + Intronic
1021301149 7:18974644-18974666 TTGTTGGCATGGGGAACAGATGG + Intronic
1021785213 7:24144371-24144393 TTGCTGGCTTCGAGGAAACAAGG + Intergenic
1022384549 7:29889097-29889119 TGGTTGGGATGGAGGGAAGCAGG - Intronic
1022556724 7:31305660-31305682 TTGTTGCCAGGGAAGAAAGGGGG + Intergenic
1022787656 7:33654599-33654621 TTGGTAGGATGGTGGAAAGATGG + Intergenic
1026223366 7:68419582-68419604 CTGTTGGCAAGGAAGAAAGGAGG - Intergenic
1026255222 7:68705353-68705375 TTCTAGGCATGGAGGAAGAAGGG - Intergenic
1027905153 7:84171024-84171046 TTTTTGGCAGAGAGAAAAGAAGG + Intronic
1028525048 7:91774815-91774837 TTCCTGGCAGGGAAGAAAGAAGG + Intronic
1028646128 7:93098679-93098701 CTGCTGGCATTGAGGAAATAAGG + Intergenic
1028921576 7:96315705-96315727 TGCTAGGAATGGAGGAAAGAAGG - Intronic
1030186796 7:106770553-106770575 TTGTTAAGATGGAGGAATGAGGG + Intergenic
1031074336 7:117198614-117198636 GGGTTGGCATGGAGCAAGGATGG - Intronic
1033766865 7:144503082-144503104 TTTTTGCCATGGAGAATAGATGG - Intronic
1034098815 7:148434648-148434670 TTGGTGGCATGGAGGACAGCCGG - Intergenic
1034746956 7:153531380-153531402 ATGTGGGCAAGGATGAAAGAGGG - Intergenic
1036945902 8:13094713-13094735 TTGTTGGCATTGGGGAAAAATGG - Intronic
1037086208 8:14853892-14853914 GTATTGGCAAGGAGGAAGGAAGG - Intronic
1037090863 8:14916395-14916417 TAGATAGCATGGAAGAAAGAAGG + Intronic
1037411228 8:18599828-18599850 TTGTGTGCATGGAGGGATGACGG + Intronic
1038431212 8:27501288-27501310 TTGTTGGAAGGTAAGAAAGAGGG + Intronic
1038431591 8:27504691-27504713 CTGTTGTCAAGGAGGAAGGAGGG + Intronic
1038452801 8:27650730-27650752 TTGTTGGCATGGAGGAAAGAGGG - Intronic
1039107057 8:34001278-34001300 TTGTTAGCTTGGTTGAAAGATGG + Intergenic
1039455288 8:37701883-37701905 TTGTTGGGAGGAAGGAAGGAAGG + Intergenic
1039899248 8:41739651-41739673 TTGTCAGCATGGAGGTGAGAAGG + Intronic
1041333487 8:56753487-56753509 TTGTTCTAAAGGAGGAAAGAGGG + Intergenic
1042042223 8:64604712-64604734 ATGTAGGACTGGAGGAAAGATGG + Exonic
1042104960 8:65316296-65316318 ATGCAGGCAGGGAGGAAAGAGGG + Intergenic
1043199717 8:77351376-77351398 TAGTTGGAATGGAGATAAGATGG - Intergenic
1043487724 8:80714897-80714919 TTGTATGCATGGAGGCAAAATGG - Intronic
1044562148 8:93623072-93623094 TTATTGGAAGGAAGGAAAGAAGG + Intergenic
1044727665 8:95206632-95206654 CTGTTGGGAAGGAGGAAAGAGGG - Intergenic
1045403195 8:101839228-101839250 TTGTTGGCATCGGGGAGAGAGGG + Intronic
1046618901 8:116506919-116506941 TTCCTGGGGTGGAGGAAAGAAGG - Intergenic
1046895272 8:119464615-119464637 TTGTTGTTTTGGAGGAAAGAAGG - Intergenic
1047032168 8:120894163-120894185 TTGGGGGCAGGGAGGAAGGAGGG - Intergenic
1047125699 8:121958020-121958042 TTGTTGCCCTGGATGGAAGATGG + Intergenic
1047164415 8:122421193-122421215 TTGGGGGCAGGGAGGACAGAGGG + Intergenic
1048458016 8:134595672-134595694 GTCTTGGCATTGAGGAAATATGG - Intronic
1049695822 8:143983857-143983879 GAGTTGGAATGGATGAAAGATGG + Intronic
1050144977 9:2557391-2557413 ACGTGGGAATGGAGGAAAGAGGG + Intergenic
1051467660 9:17398915-17398937 TTTTTGGCAGAGAGGGAAGAAGG - Intronic
1051518591 9:17958715-17958737 TCTTTGGCATGGAAGAAATACGG - Intergenic
1053194295 9:36103687-36103709 TTGTTGGCCTTGAGAAAATATGG - Intronic
1053599355 9:39594320-39594342 CTGTTGGTATGGAGGACAGAAGG + Intergenic
1053857060 9:42348506-42348528 CTGTTGGTATGGAGGACAGAAGG + Intergenic
1054254169 9:62748066-62748088 CTATTGGTATGGAGGACAGAAGG - Intergenic
1054568234 9:66782236-66782258 CTATTGGTATGGAGGACAGAAGG - Intergenic
1054696432 9:68364351-68364373 TTCTTGGGGTGGAAGAAAGAAGG + Intronic
1056235259 9:84587991-84588013 GTGTTGGCATGGAAGACAGAGGG - Intergenic
1059287267 9:113185335-113185357 TTGTGGGAAGAGAGGAAAGAGGG + Intronic
1059326657 9:113507797-113507819 TTCTTGGTAGGGAGGACAGATGG + Intronic
1059826860 9:118040022-118040044 TTGTTGGCATCTAGGAGAGGTGG + Intergenic
1060362850 9:122977086-122977108 TTGTGGGCATTGAGGAACCATGG + Intronic
1061284332 9:129613590-129613612 CTGTTGGACTGCAGGAAAGAGGG + Exonic
1061421983 9:130477622-130477644 CTCTTGGCCTGGAGGAAGGATGG + Intronic
1061642839 9:131973205-131973227 TTGTTCATAAGGAGGAAAGAGGG - Intronic
1186499025 X:10036077-10036099 TTTTTTTAATGGAGGAAAGACGG - Intronic
1186952127 X:14638123-14638145 TTGTTAGCATGTAGGTAAAAGGG + Intronic
1187258548 X:17663193-17663215 TTCGTGGCATGGAGGGGAGAGGG + Intronic
1189373495 X:40448347-40448369 AAGGTGGTATGGAGGAAAGATGG - Intergenic
1189424790 X:40889270-40889292 TTGTTTGCAAGGAGGAATCAGGG + Intergenic
1190558738 X:51666106-51666128 TTCAAAGCATGGAGGAAAGAAGG + Intergenic
1191872018 X:65754625-65754647 ATGTTGGCATGGATGTGAGAAGG + Intergenic
1192587845 X:72333951-72333973 ATGTTCGCAGGGAGGAAAGGTGG + Intronic
1196481833 X:116159193-116159215 TTTTTGGCTGGCAGGAAAGATGG + Intergenic
1197404118 X:126029103-126029125 GTGGTTGTATGGAGGAAAGAAGG + Intergenic
1197816852 X:130506586-130506608 TTGAAGGGAGGGAGGAAAGAAGG - Intergenic
1197857426 X:130931100-130931122 TGGTTGGCAGGGATGAAAGAGGG + Intergenic
1198314016 X:135448985-135449007 TTGTTGTTTTGGAGGAAAAAAGG - Intergenic
1198703903 X:139426580-139426602 TGGGTGGCATGGATGAAATAGGG - Intergenic
1199178833 X:144827872-144827894 TTTAAGGCATGGAAGAAAGAAGG + Intergenic