ID: 1038454930

View in Genome Browser
Species Human (GRCh38)
Location 8:27666958-27666980
Sequence ACACCCTGGAGTCCGGTGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 176
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 161}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1038454930_1038454939 7 Left 1038454930 8:27666958-27666980 CCCTCCACCGGACTCCAGGGTGT 0: 1
1: 0
2: 0
3: 14
4: 161
Right 1038454939 8:27666988-27667010 CCTCTCCTTCCCACGCACCTCGG 0: 1
1: 0
2: 2
3: 46
4: 1093
1038454930_1038454945 30 Left 1038454930 8:27666958-27666980 CCCTCCACCGGACTCCAGGGTGT 0: 1
1: 0
2: 0
3: 14
4: 161
Right 1038454945 8:27667011-27667033 CCACTGTTGCCCATCTTCCTTGG 0: 1
1: 0
2: 1
3: 18
4: 230

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1038454930 Original CRISPR ACACCCTGGAGTCCGGTGGA GGG (reversed) Intronic
905332333 1:37213820-37213842 ACACTCTGGGGTCTGGTGGGGGG + Intergenic
913999172 1:143678208-143678230 ACACACTGGAGCCTGTTGGAAGG + Intergenic
916753643 1:167746547-167746569 GCACCCTGGAATCAGATGGAAGG + Intronic
917890817 1:179436673-179436695 ACACACTGGAGCCTGTTGGAGGG + Intronic
918133581 1:181649832-181649854 ACACACTGGAGTCTTTTGGAGGG + Intronic
918619481 1:186585987-186586009 ACAGGCTGGAGTGCAGTGGAGGG + Intergenic
920758128 1:208755028-208755050 GCAGCATGGAGTCGGGTGGAGGG - Intergenic
922459198 1:225801645-225801667 CCACCCTGGAGTGCAGTGGCAGG - Intergenic
923085069 1:230696915-230696937 ACACACTGGAGTGAGGGGGAAGG - Intergenic
1063686419 10:8241075-8241097 GCACCCTGGAGTCCTGCAGATGG - Intergenic
1064575246 10:16738869-16738891 ACACCCTGGGGTCCGCTGGGGGG - Intronic
1065793260 10:29281255-29281277 CCAGCCTGGAGGCAGGTGGATGG - Intergenic
1069386414 10:67886510-67886532 CCACCCTGGAGTGCAGTGGCAGG - Intronic
1069690691 10:70349916-70349938 TCACCCTAGATTCAGGTGGATGG + Intronic
1070662893 10:78320168-78320190 CCACCTGGGAGTCAGGTGGAGGG + Intergenic
1073214800 10:101830289-101830311 ATACCCTGGCGTCTGGAGGAGGG + Intronic
1074133474 10:110606366-110606388 CCACGCTGGAGTGCGGTGGCAGG + Intergenic
1075023480 10:118967630-118967652 CCACCCTGAAGTCCGGTGCTGGG + Intergenic
1075980962 10:126739160-126739182 ACAGCCTGAAGTCAGGAGGAAGG + Intergenic
1076437763 10:130458220-130458242 ACACCCAGGAATCCGGGGAAGGG + Intergenic
1077139890 11:1019649-1019671 ACAGCCAGGAGTACGGTGGGAGG - Intronic
1077174666 11:1183417-1183439 CCACCATGGGGTCCGGGGGACGG - Intronic
1077174883 11:1184536-1184558 CCACCATGGGGTCCGGGGGACGG - Intronic
1077278797 11:1732669-1732691 ATACCCTGGGGACCGGGGGAGGG - Exonic
1077454425 11:2669926-2669948 ACAGTCTGGAGTCAGGTGGAGGG + Intronic
1079943338 11:26710026-26710048 ACACACTGGAGGCCTGTGGGTGG - Intronic
1080306072 11:30838060-30838082 CCACCCTGGAGTGCAGTGGCGGG + Intronic
1081262897 11:40982832-40982854 ACACCCTGGGGACCATTGGAGGG - Intronic
1083932374 11:65853014-65853036 ACACCCTGGTGCCTGGGGGAGGG - Intronic
1084809521 11:71603753-71603775 ACACCCTGGAGACAGGTGTGGGG + Intergenic
1086271546 11:85073247-85073269 ACACCCTGGAGTGACCTGGAAGG - Intronic
1086848642 11:91782892-91782914 CCATTCTGGGGTCCGGTGGATGG + Intergenic
1089561259 11:119344387-119344409 ACACCCTGTAGAGAGGTGGAAGG + Exonic
1090189002 11:124756326-124756348 ACACCCTGGAGACGGCAGGATGG + Exonic
1092296364 12:7202278-7202300 TGTCCCTGGAGTCCGGTGCAGGG + Exonic
1099402003 12:82211634-82211656 TGACCCTGGAGTCCTGTGAAGGG - Intergenic
1099832054 12:87856564-87856586 ACACACTGGGGCACGGTGGAGGG + Intergenic
1105935248 13:25092471-25092493 ACACACTGGAGTCTGCTGGAGGG - Intergenic
1106866507 13:33970096-33970118 ACACACTGGGGTCTGTTGGAGGG - Intergenic
1108785847 13:53900306-53900328 ACACGCTGGGGTCTGTTGGAGGG + Intergenic
1109274757 13:60291063-60291085 AGACTCTGGAGTCTGGTGGCAGG - Intergenic
1110191465 13:72734037-72734059 ACACACTGGGGCCTGGTGGAGGG + Intronic
1111601595 13:90481659-90481681 ACACTCTGGAGTCTGGGGGATGG + Intergenic
1112185764 13:97126403-97126425 ACACCCTGGAGGCAGGAGGCAGG + Intergenic
1120921030 14:89755635-89755657 CCACTCTGGAGTCTGGAGGATGG + Intergenic
1122192502 14:100057195-100057217 ACTCCCAGGAGTCCAGTGGTGGG + Intronic
1122831395 14:104398863-104398885 CCAGCCTAGAGTCAGGTGGAGGG - Intergenic
1125971380 15:43914569-43914591 ACAACCTGGAGTCCTGTTAATGG + Intronic
1129748193 15:78039553-78039575 ACTTCCTTGAGTCAGGTGGATGG - Intronic
1132513856 16:357002-357024 ACAGCCTGGAAGGCGGTGGAGGG - Intergenic
1135029990 16:19030620-19030642 ACAGACTGGAGTGCGGTGGCGGG + Intronic
1135749100 16:25042323-25042345 ACACTCTGGGGTCTGCTGGAGGG - Intergenic
1139489637 16:67279442-67279464 GCCCCCTGGAGGCCGGAGGACGG - Exonic
1139765600 16:69226571-69226593 TCACACTGGAGTGCGGTGGTGGG + Intronic
1140535951 16:75709905-75709927 TGACCCTGGAGTCCTGTGAAGGG - Intronic
1143281606 17:5758674-5758696 CCACCCTGGAGTCAGTTTGATGG + Intergenic
1147327394 17:39676049-39676071 AGAGCCTTGAGTCTGGTGGAAGG - Intronic
1147571799 17:41576061-41576083 TCACCCTGGAGTGCAGTGGCTGG - Intergenic
1150711324 17:67532987-67533009 ACACCATGGGGTCAGGTGGGAGG - Intronic
1151539965 17:74759787-74759809 GCACCCTGCAGTGTGGTGGAAGG + Intronic
1151907248 17:77056561-77056583 ACACCCGGGACTCCGGGGGGAGG - Intergenic
1152315462 17:79578019-79578041 ACACTCTGGGGCCAGGTGGAGGG - Intergenic
1153456795 18:5291645-5291667 ACACCCCCGAGTCAGGAGGACGG - Exonic
1155828038 18:30473709-30473731 CCACCCTGGAGTGCAGTGGCGGG - Intergenic
1159568983 18:70090664-70090686 CCACCCTTGAGTCCTGTGGTGGG - Intronic
1159651761 18:70986504-70986526 ACACTCTGGGGTCTGGAGGATGG - Intergenic
1159969559 18:74632537-74632559 GCAGCCCGGAGTCCGGAGGACGG - Exonic
1160938841 19:1610540-1610562 ACACCCTGGAGCCCGGTGCTGGG - Exonic
1161136810 19:2624830-2624852 ACACCCTGGAGCCTGTGGGATGG - Intronic
1161261137 19:3338532-3338554 CCTCCCTGGAGCCCAGTGGAGGG + Intergenic
1161781169 19:6293007-6293029 TGACCCTGGAGTCCTGTGAAGGG - Intergenic
1162139511 19:8577416-8577438 AAAGCCGGGAGTCCGGTGAACGG - Exonic
1162672137 19:12266274-12266296 ACACCCTGGAGTCCAGGAAATGG - Intronic
1163603264 19:18261109-18261131 ACACCCTGGAGGCCACTGGTGGG + Intronic
1165446260 19:35858390-35858412 CCACCCTGGAGTCAGGGAGAAGG - Exonic
1165523326 19:36331505-36331527 GCGCCCACGAGTCCGGTGGACGG + Intergenic
1165633108 19:37318106-37318128 GCGCCCACGAGTCCGGTGGACGG - Intronic
1168408149 19:56121256-56121278 AGACCCTGGGGTCAGGGGGACGG + Exonic
924968414 2:100318-100340 ACAGCATGGAGTACGATGGACGG + Intergenic
925018004 2:546306-546328 GCTCCCTGGAGTTCGGTGGGAGG - Intergenic
925441227 2:3887474-3887496 ACACACTGGGGTCTGTTGGAGGG - Intergenic
925485591 2:4325958-4325980 ACACTCTGGGGTCTGTTGGAGGG - Intergenic
930171994 2:48261336-48261358 ACACACAGGAGTCAGGTGAAGGG - Intergenic
930193342 2:48482945-48482967 ACACACTGGAGCCTGATGGAGGG - Intronic
933793508 2:85902400-85902422 ACATCCGGGAGTCCTGGGGAAGG - Intergenic
937789615 2:125944401-125944423 ACATCCTGGAGCCCAGGGGAAGG + Intergenic
939280970 2:140064351-140064373 ACAACCTGGAGTCAAGAGGAAGG + Intergenic
940807799 2:158207474-158207496 AGAGCCTGGAGTCCTGGGGATGG - Intronic
941510374 2:166400805-166400827 ACACCCTGGGGTCTTTTGGAGGG + Intergenic
948333483 2:237190247-237190269 GCATCCTGGAGCCTGGTGGATGG + Intergenic
1171135105 20:22688534-22688556 AAGCCCTGGAGTCCCCTGGAGGG - Intergenic
1175713405 20:61239331-61239353 ACACACTGGTGTCCCGTGAATGG - Intergenic
1175888574 20:62305966-62305988 ACACCCGGGATTGCGGCGGATGG + Intronic
1176274514 20:64256032-64256054 ACGCCCTGGAGGCCGCTGGGGGG - Intronic
1179021403 21:37644206-37644228 ACACACTGGGGCCTGGTGGAGGG + Intronic
1181008585 22:20026798-20026820 ACACCCTGGAGGCAGGTGAGTGG + Intronic
1181572364 22:23774503-23774525 AAGCCCTGCAGTCCGATGGATGG + Intronic
1181865915 22:25855109-25855131 ACACACTGGAGCCTGTTGGAGGG - Intronic
1184031625 22:41898487-41898509 ACACCCAGGATTCTGGGGGAGGG - Intronic
950061511 3:10075772-10075794 ACAGGCTGGAGTGCGGTGGTGGG + Intronic
953498654 3:43411610-43411632 GCACCATGGAGCCCTGTGGAAGG - Intronic
954074959 3:48171328-48171350 ACACGCTGGAGTGCAGTGGCAGG - Intronic
955544591 3:60014291-60014313 ACTCTCTGGAGTTCAGTGGATGG - Intronic
955761604 3:62290382-62290404 ACACGATGGAGTCGGGTGGAAGG + Intronic
961922373 3:130441197-130441219 ACACCCTGGAGACCTGTGTGAGG + Intronic
962325383 3:134427992-134428014 ACACCCTGTAGTCTGGGGCAGGG + Intergenic
963657373 3:148073951-148073973 ACACCCTGGTGTCCCGTGTGTGG + Intergenic
964241602 3:154601185-154601207 CCATTCTGGAGTCCGGAGGATGG + Intergenic
965928441 3:174012174-174012196 ACACCTTGGAGGCCTGTGCAGGG - Intronic
968982108 4:3855843-3855865 ACTCCTGGGAGGCCGGTGGACGG - Intergenic
969731465 4:8960119-8960141 ACACCCTGGAGACAGGTGTGGGG + Intergenic
969791070 4:9494227-9494249 ACACCCTGGAGACAGGTGTGGGG + Intergenic
971187055 4:24388801-24388823 ACACACTGGAGCCTGTTGGAGGG + Intergenic
972032571 4:34479680-34479702 ACACACTGGGGCCCGTTGGAGGG + Intergenic
972698986 4:41475695-41475717 ACACCCTGGGGCCTGTTGGAGGG + Intronic
977566224 4:98583420-98583442 ACACCCTGGGGCCTGGTGGAGGG - Intronic
980182163 4:129414494-129414516 AGACCCTGGAGAAGGGTGGAGGG + Intergenic
981289153 4:143053763-143053785 ACACACTGGGGTCTGCTGGATGG - Intergenic
982301549 4:153883691-153883713 ACACTCTGAAGCCTGGTGGAGGG + Intergenic
982496227 4:156095941-156095963 CCAGCCTGGAGTTCAGTGGAAGG + Intergenic
984516966 4:180752909-180752931 CCACGCTGGAGTCTGGAGGATGG + Intergenic
985102120 4:186468893-186468915 ACAGGCTGGAGTCCAGTGGAGGG + Intronic
985666645 5:1184566-1184588 ACGCCCTGGGGTCAGGTGGACGG + Intergenic
986911140 5:12558934-12558956 CCAGCCTGGAGTCCAGTGGCAGG + Intergenic
989693823 5:44175990-44176012 ACACACTGGAGCCCTTTGGACGG + Intergenic
995120970 5:108534870-108534892 CCACCCTGGAGTGCAGTGGTGGG + Intergenic
996777989 5:127153548-127153570 ACACACTGGAGCCTGTTGGAAGG - Intergenic
997305136 5:132830873-132830895 ACGCGCTGGAGGCCGGTGGGCGG - Exonic
998581822 5:143384816-143384838 CCACTCTGGAGTCTGGAGGATGG + Intronic
998806798 5:145925212-145925234 ACACTCTGGAGTCAGATGGCTGG - Intergenic
998917921 5:147036175-147036197 ACACACTGGGGTCTGTTGGAAGG - Intronic
1001848457 5:174941921-174941943 AAACCATGGAGCCAGGTGGAAGG + Intergenic
1003444109 6:6169241-6169263 ACAGCCTGGGTTCCAGTGGAAGG + Intronic
1003479777 6:6520287-6520309 ACACACTGGGGTCTGGTGGAGGG + Intergenic
1003492277 6:6633594-6633616 ACACACTGGGGTCTGTTGGAGGG - Intronic
1003984967 6:11426272-11426294 ACAGCCTGGAGTCCACTGGAGGG + Intergenic
1004764843 6:18714525-18714547 ACACACTGGGGTCTGGTGGAGGG - Intergenic
1006217102 6:32453768-32453790 TCACTCTGGAGTCTGGAGGATGG - Intergenic
1006780864 6:36631519-36631541 CCTCCCTGGAGCCAGGTGGACGG + Intergenic
1010111848 6:72245845-72245867 ACTCACTGGACTCCAGTGGAGGG - Exonic
1015117615 6:129666615-129666637 AGGCCCTGGAGTCAGGTTGAAGG - Intronic
1016479065 6:144462069-144462091 ACACACTGGGGTCTGTTGGAGGG - Intronic
1018395410 6:163374547-163374569 CAACCCTGGAGCCCTGTGGACGG - Intergenic
1019150391 6:170001605-170001627 CCATCCTGGAGTCTGGAGGACGG + Intergenic
1019745082 7:2695300-2695322 CCACGCTGGAGTCTGGTGGTGGG + Intronic
1022465333 7:30649568-30649590 ACACCCTGGTGTTCTGTGAATGG + Intergenic
1023087488 7:36586010-36586032 ACACCATGGATCCTGGTGGAGGG - Intronic
1024053723 7:45646316-45646338 CCACGCTGGAGTCCAGTGAATGG + Intronic
1026532611 7:71212521-71212543 TCATTCTGGAGTCTGGTGGACGG - Intronic
1026894872 7:74004164-74004186 AGTCCCTGCAGACCGGTGGATGG - Intergenic
1026970543 7:74465005-74465027 CCACCCTGGAGCCAGGTGGGTGG - Intronic
1030005353 7:105112842-105112864 AGACCTTGGAGTCCTGTGGATGG - Exonic
1031435582 7:121728463-121728485 CCACTCTGGGGTCTGGTGGATGG + Intergenic
1034684940 7:152962156-152962178 ACACCCTGGGGCCTGTTGGAGGG + Intergenic
1036284630 8:7433155-7433177 ACACCCTGGATTCCCGTGCTGGG - Intergenic
1036336845 8:7878375-7878397 ACACCCTGGATTCCCGTGCTGGG + Intergenic
1038454930 8:27666958-27666980 ACACCCTGGAGTCCGGTGGAGGG - Intronic
1038814124 8:30883514-30883536 ACACACTGGGGTCTGTTGGAGGG - Intronic
1040094546 8:43431286-43431308 AAACCCTGGAATCTGGTAGAGGG - Intergenic
1040559894 8:48514731-48514753 CCACCCTGGCGTCCGGGGGCTGG + Intergenic
1042694541 8:71542227-71542249 ACACCCTGGAGTCTATCGGAGGG - Intronic
1044008202 8:86962906-86962928 TGACCCTGGAGTCCTGTGAAGGG + Intronic
1052019397 9:23508463-23508485 CCATCCTGGAGTCTGGAGGATGG - Intergenic
1054938297 9:70712764-70712786 ACACCCTGGGGTCTGATGAAAGG + Intronic
1054939988 9:70730757-70730779 ACACCCTGGGGTCTGATGAAAGG + Intronic
1060869872 9:127030918-127030940 ACACCCTGGTGACAGGAGGAAGG + Intronic
1060937956 9:127526884-127526906 ACGCCCTGGAGCCAGCTGGAGGG + Intronic
1062008745 9:134255929-134255951 ACACTCTAGGGTCCTGTGGACGG + Intergenic
1185830220 X:3294393-3294415 CCACCCTGGAGCCAGGTGGCTGG - Intergenic
1190584705 X:51927518-51927540 ACACACTGGAGCCTGTTGGAGGG - Intergenic
1192725326 X:73745026-73745048 ACACACTGGGGTCTGTTGGAAGG - Intergenic
1192937502 X:75875826-75875848 ACACACTGGGGTCTGTTGGAGGG - Intergenic
1193468124 X:81871210-81871232 TGACCCTGGAGTCCTGTGAAGGG + Intergenic
1193843402 X:86438042-86438064 ACACCCTGGAGCCTGTTGGAGGG - Intronic
1194956717 X:100189636-100189658 ACACCCTGGGCTGAGGTGGAGGG + Intergenic
1196346358 X:114664378-114664400 ACACACTGGAGTCTGGAGGTGGG - Intronic