ID: 1038455348

View in Genome Browser
Species Human (GRCh38)
Location 8:27669116-27669138
Sequence GAAGTGAGCCCAGGAGGAGT CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1038455339_1038455348 6 Left 1038455339 8:27669087-27669109 CCAGGGAGCTGGGGACAAGCCCT 0: 1
1: 0
2: 0
3: 42
4: 376
Right 1038455348 8:27669116-27669138 GAAGTGAGCCCAGGAGGAGTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1038455348 Original CRISPR GAAGTGAGCCCAGGAGGAGT CGG Intronic
No off target data available for this crispr