ID: 1038461892

View in Genome Browser
Species Human (GRCh38)
Location 8:27724095-27724117
Sequence GATGACTTGCCATCAATCAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1038461888_1038461892 14 Left 1038461888 8:27724058-27724080 CCAGAGGTCAACAGTGAATTCCC No data
Right 1038461892 8:27724095-27724117 GATGACTTGCCATCAATCACAGG No data
1038461891_1038461892 -7 Left 1038461891 8:27724079-27724101 CCACAACTCTCGGCTTGATGACT No data
Right 1038461892 8:27724095-27724117 GATGACTTGCCATCAATCACAGG No data
1038461890_1038461892 -6 Left 1038461890 8:27724078-27724100 CCCACAACTCTCGGCTTGATGAC No data
Right 1038461892 8:27724095-27724117 GATGACTTGCCATCAATCACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1038461892 Original CRISPR GATGACTTGCCATCAATCAC AGG Intergenic
No off target data available for this crispr