ID: 1038462446

View in Genome Browser
Species Human (GRCh38)
Location 8:27728504-27728526
Sequence GTTTAGGGAGGATTAGCCGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1038462446_1038462463 24 Left 1038462446 8:27728504-27728526 CCAGCGGCTAATCCTCCCTAAAC No data
Right 1038462463 8:27728551-27728573 ATTCTGGAGGGGCCGTCGCTGGG No data
1038462446_1038462455 11 Left 1038462446 8:27728504-27728526 CCAGCGGCTAATCCTCCCTAAAC No data
Right 1038462455 8:27728538-27728560 AGCCTCCACTCCCATTCTGGAGG No data
1038462446_1038462458 13 Left 1038462446 8:27728504-27728526 CCAGCGGCTAATCCTCCCTAAAC No data
Right 1038462458 8:27728540-27728562 CCTCCACTCCCATTCTGGAGGGG No data
1038462446_1038462456 12 Left 1038462446 8:27728504-27728526 CCAGCGGCTAATCCTCCCTAAAC No data
Right 1038462456 8:27728539-27728561 GCCTCCACTCCCATTCTGGAGGG No data
1038462446_1038462462 23 Left 1038462446 8:27728504-27728526 CCAGCGGCTAATCCTCCCTAAAC No data
Right 1038462462 8:27728550-27728572 CATTCTGGAGGGGCCGTCGCTGG No data
1038462446_1038462464 25 Left 1038462446 8:27728504-27728526 CCAGCGGCTAATCCTCCCTAAAC No data
Right 1038462464 8:27728552-27728574 TTCTGGAGGGGCCGTCGCTGGGG No data
1038462446_1038462453 8 Left 1038462446 8:27728504-27728526 CCAGCGGCTAATCCTCCCTAAAC No data
Right 1038462453 8:27728535-27728557 TCCAGCCTCCACTCCCATTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1038462446 Original CRISPR GTTTAGGGAGGATTAGCCGC TGG (reversed) Intergenic
No off target data available for this crispr