ID: 1038462456

View in Genome Browser
Species Human (GRCh38)
Location 8:27728539-27728561
Sequence GCCTCCACTCCCATTCTGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1038462446_1038462456 12 Left 1038462446 8:27728504-27728526 CCAGCGGCTAATCCTCCCTAAAC No data
Right 1038462456 8:27728539-27728561 GCCTCCACTCCCATTCTGGAGGG No data
1038462449_1038462456 -4 Left 1038462449 8:27728520-27728542 CCTAAACCCACCTTCTCCAGCCT No data
Right 1038462456 8:27728539-27728561 GCCTCCACTCCCATTCTGGAGGG No data
1038462442_1038462456 28 Left 1038462442 8:27728488-27728510 CCCTGTCCTAGAGGATCCAGCGG No data
Right 1038462456 8:27728539-27728561 GCCTCCACTCCCATTCTGGAGGG No data
1038462445_1038462456 22 Left 1038462445 8:27728494-27728516 CCTAGAGGATCCAGCGGCTAATC No data
Right 1038462456 8:27728539-27728561 GCCTCCACTCCCATTCTGGAGGG No data
1038462447_1038462456 0 Left 1038462447 8:27728516-27728538 CCTCCCTAAACCCACCTTCTCCA No data
Right 1038462456 8:27728539-27728561 GCCTCCACTCCCATTCTGGAGGG No data
1038462450_1038462456 -10 Left 1038462450 8:27728526-27728548 CCCACCTTCTCCAGCCTCCACTC No data
Right 1038462456 8:27728539-27728561 GCCTCCACTCCCATTCTGGAGGG No data
1038462448_1038462456 -3 Left 1038462448 8:27728519-27728541 CCCTAAACCCACCTTCTCCAGCC No data
Right 1038462456 8:27728539-27728561 GCCTCCACTCCCATTCTGGAGGG No data
1038462444_1038462456 27 Left 1038462444 8:27728489-27728511 CCTGTCCTAGAGGATCCAGCGGC No data
Right 1038462456 8:27728539-27728561 GCCTCCACTCCCATTCTGGAGGG No data
1038462441_1038462456 29 Left 1038462441 8:27728487-27728509 CCCCTGTCCTAGAGGATCCAGCG No data
Right 1038462456 8:27728539-27728561 GCCTCCACTCCCATTCTGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1038462456 Original CRISPR GCCTCCACTCCCATTCTGGA GGG Intergenic
No off target data available for this crispr