ID: 1038462462

View in Genome Browser
Species Human (GRCh38)
Location 8:27728550-27728572
Sequence CATTCTGGAGGGGCCGTCGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1038462450_1038462462 1 Left 1038462450 8:27728526-27728548 CCCACCTTCTCCAGCCTCCACTC No data
Right 1038462462 8:27728550-27728572 CATTCTGGAGGGGCCGTCGCTGG No data
1038462451_1038462462 0 Left 1038462451 8:27728527-27728549 CCACCTTCTCCAGCCTCCACTCC No data
Right 1038462462 8:27728550-27728572 CATTCTGGAGGGGCCGTCGCTGG No data
1038462449_1038462462 7 Left 1038462449 8:27728520-27728542 CCTAAACCCACCTTCTCCAGCCT No data
Right 1038462462 8:27728550-27728572 CATTCTGGAGGGGCCGTCGCTGG No data
1038462452_1038462462 -3 Left 1038462452 8:27728530-27728552 CCTTCTCCAGCCTCCACTCCCAT No data
Right 1038462462 8:27728550-27728572 CATTCTGGAGGGGCCGTCGCTGG No data
1038462447_1038462462 11 Left 1038462447 8:27728516-27728538 CCTCCCTAAACCCACCTTCTCCA No data
Right 1038462462 8:27728550-27728572 CATTCTGGAGGGGCCGTCGCTGG No data
1038462448_1038462462 8 Left 1038462448 8:27728519-27728541 CCCTAAACCCACCTTCTCCAGCC No data
Right 1038462462 8:27728550-27728572 CATTCTGGAGGGGCCGTCGCTGG No data
1038462446_1038462462 23 Left 1038462446 8:27728504-27728526 CCAGCGGCTAATCCTCCCTAAAC No data
Right 1038462462 8:27728550-27728572 CATTCTGGAGGGGCCGTCGCTGG No data
1038462454_1038462462 -9 Left 1038462454 8:27728536-27728558 CCAGCCTCCACTCCCATTCTGGA No data
Right 1038462462 8:27728550-27728572 CATTCTGGAGGGGCCGTCGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1038462462 Original CRISPR CATTCTGGAGGGGCCGTCGC TGG Intergenic
No off target data available for this crispr