ID: 1038463242

View in Genome Browser
Species Human (GRCh38)
Location 8:27734678-27734700
Sequence CTATAGTATGAGAGGTCCTG GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 102
Summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 95}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1038463242_1038463246 30 Left 1038463242 8:27734678-27734700 CCCCAGGACCTCTCATACTATAG 0: 1
1: 0
2: 1
3: 5
4: 95
Right 1038463246 8:27734731-27734753 TCTACATGTGTTGCAGTGTGAGG 0: 1
1: 0
2: 0
3: 14
4: 175

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1038463242 Original CRISPR CTATAGTATGAGAGGTCCTG GGG (reversed) Exonic
904965390 1:34368842-34368864 CTCTAGAGTAAGAGGTCCTGAGG - Intergenic
905522879 1:38613878-38613900 GGAGAGAATGAGAGGTCCTGGGG - Intergenic
915896863 1:159818583-159818605 CTACTGTCTGAGAGGTGCTGTGG + Intergenic
916604406 1:166326651-166326673 TTCGAGTATGAGAGGCCCTGTGG + Intergenic
916784180 1:168071953-168071975 CAATTGTATGTGAAGTCCTGGGG - Intronic
916830935 1:168490200-168490222 CTATAATATGAGGGGTATTGAGG + Intergenic
920737752 1:208549961-208549983 CTGCAGTATGTGTGGTCCTGGGG - Intergenic
1068101518 10:52559739-52559761 CTAATGTTTGAGAAGTCCTGGGG - Intergenic
1069882239 10:71600853-71600875 CCATGGTATCAGAGTTCCTGGGG + Intronic
1069937003 10:71924445-71924467 CTAGAGCATCACAGGTCCTGAGG + Intergenic
1075289108 10:121213292-121213314 GTATGGTATTAGAGGTCTTGTGG - Intergenic
1087096835 11:94327185-94327207 CTATATTATGAGCTGTTCTGTGG - Intergenic
1091667068 12:2426811-2426833 CTAAAGAATGAGAGGCCATGTGG - Intronic
1092443872 12:8535085-8535107 CTATAGAATGAGAAGTTATGGGG + Intronic
1099210494 12:79782094-79782116 CTAAACTATGAAAGTTCCTGGGG - Intronic
1100599973 12:96104665-96104687 CTGTAGAATGAGAAGTACTGGGG + Intergenic
1101299024 12:103458822-103458844 CTAAATTGTGAGAGATCCTGTGG - Intronic
1102072543 12:110033655-110033677 CTATTATATGAGAGATTCTGAGG - Intronic
1108756414 13:53508429-53508451 CTGGAGAATGAGAGATCCTGTGG + Intergenic
1111879795 13:93942300-93942322 CTATGTTGTGAGATGTCCTGAGG - Intronic
1117060564 14:51958369-51958391 CTATCCACTGAGAGGTCCTGGGG - Intronic
1118123827 14:62876664-62876686 ATATAGTATGTGAGGTTTTGTGG - Intronic
1118597533 14:67447613-67447635 CTATAGGAGAAGTGGTCCTGAGG - Intronic
1124188802 15:27553415-27553437 CTATACTGTGAGAGGTCCTGAGG - Intergenic
1130140831 15:81225052-81225074 CTATAGAATGAGAAGCTCTGGGG + Intronic
1134593314 16:15475026-15475048 CTATAGTATGAGGGGTGGTTGGG + Intronic
1135778545 16:25278412-25278434 CTATAGAATGAGAGGCCACGTGG - Intergenic
1139140117 16:64251939-64251961 CTGGAGAATGAGAGGTCATGTGG - Intergenic
1143022051 17:3921886-3921908 CTGTGGTATGAGAGGTCTTACGG + Intergenic
1148243616 17:46015947-46015969 CTCGAGTCTGAGAGGCCCTGTGG - Intronic
1149233266 17:54561127-54561149 AGAAAGTATGAGAGGTTCTGGGG - Intergenic
1153390540 18:4552738-4552760 CAATAGTATGAGGGTGCCTGTGG - Intergenic
1156323572 18:36051617-36051639 CTATTGTATGCTAGGTTCTGAGG + Intronic
1159707288 18:71707298-71707320 CTATACTATGAGGGGTGGTGAGG - Intergenic
1160063311 18:75551454-75551476 TTATATTATATGAGGTCCTGGGG - Intergenic
1160409673 18:78667228-78667250 CTGTCTTATGAGAGGGCCTGGGG - Intergenic
1162889249 19:13720485-13720507 CTATAGTATGGGGGTTTCTGGGG - Intergenic
1164588899 19:29495319-29495341 CTATTGAATAAGAGGGCCTGCGG + Intergenic
930526177 2:52533050-52533072 CTAAAGTATGAGGGATCATGTGG - Intergenic
931730213 2:65146721-65146743 TTATAAAATGTGAGGTCCTGAGG - Intergenic
935303947 2:101718726-101718748 TTAGAGTATGAGAGGCTCTGAGG - Intronic
936061750 2:109299238-109299260 CTAAAGAGTGAGAGGTCCTTTGG - Intronic
939603691 2:144225825-144225847 CTATAGTATAAGAGGGATTGTGG - Intronic
945505439 2:210634639-210634661 CTACATCATGAGAGGTGCTGTGG - Intronic
945622054 2:212152176-212152198 CTCTAGAATCAGAGTTCCTGTGG + Intronic
947260486 2:228216454-228216476 CTATTGTTTGAGTGTTCCTGTGG + Intergenic
947538662 2:230958787-230958809 CCATAGGGTGAGAGGTCCTTGGG - Intronic
1171100537 20:22379625-22379647 CTGGAGGATGAGAGGCCCTGGGG - Intergenic
1172384309 20:34522961-34522983 CTATCCTATGCGAGGTACTGGGG + Intronic
1173006355 20:39142580-39142602 ATCCAGGATGAGAGGTCCTGGGG - Intergenic
1175474671 20:59263285-59263307 CTATAGTGCCAGAGGTGCTGAGG + Intergenic
1175482754 20:59322953-59322975 TTTTTGTATGAGAGATCCTGAGG + Intronic
1176589909 21:8637600-8637622 ATACAGTGTGAGAGTTCCTGGGG + Intergenic
1177732635 21:25048058-25048080 ATATAATATGATAGGTGCTGGGG - Intergenic
1179394529 21:41026214-41026236 CTACAGGATGAGAGATCATGTGG - Intergenic
1180272742 22:10614617-10614639 ATACAGTGTGAGAGTTCCTGGGG + Intergenic
1180905281 22:19406125-19406147 ATATTGTATGTGATGTCCTGTGG - Intronic
1184240980 22:43211154-43211176 CGAGGGCATGAGAGGTCCTGGGG - Intronic
1184292156 22:43503158-43503180 CTATTGTATGCCAGGCCCTGGGG - Intronic
949137377 3:584105-584127 ATACAGTGTGAGAGTTCCTGGGG - Intergenic
952288085 3:31987624-31987646 CTAGAGGATGAGAGACCCTGTGG - Intronic
957032491 3:75257813-75257835 CTCTGGTAGGAGAGGTCTTGAGG - Intergenic
959985897 3:112570959-112570981 CTATTTTCTGAGACGTCCTGTGG + Intronic
962858754 3:139376398-139376420 CTATTATATGGGAGGCCCTGTGG + Intronic
963932539 3:151018689-151018711 ATATAATATCACAGGTCCTGCGG + Intergenic
965294099 3:166920889-166920911 CTTTAGTGTGAGTGGTCATGTGG - Intergenic
965667670 3:171112618-171112640 CAATAGAATGAGAGTTGCTGGGG + Intronic
967797979 3:193619254-193619276 TTACAGTATGAGAGGTCCTAGGG - Intronic
969603527 4:8190444-8190466 CTATGGGATTGGAGGTCCTGGGG + Intronic
978044652 4:104111799-104111821 CTGTAGTATGAAAGGTCTTTAGG + Intergenic
981992132 4:150934460-150934482 CTACAGTATGCCAGGCCCTGAGG + Intronic
984380294 4:178984475-178984497 CTATTTTCTGAGAGGTCTTGTGG + Intergenic
984555565 4:181210136-181210158 CTAAAGTATAAAAGGTTCTGAGG + Intergenic
990162635 5:52959429-52959451 ATATAGTATTATAGATCCTGTGG - Intergenic
996343100 5:122459673-122459695 CTTTAATATAAGAGGTGCTGTGG - Intronic
1000003235 5:157160000-157160022 CTAAAGTCTGAGAGGGCCTTTGG - Intronic
1003901389 6:10659024-10659046 CTAGAGGATGAGAGGCCTTGTGG - Intergenic
1005600992 6:27425806-27425828 ATATAGTTTCAGAGGTACTGTGG - Intergenic
1010531509 6:76973309-76973331 CTATGGTATGAGAGTTCATGTGG - Intergenic
1012567466 6:100676627-100676649 ATATTATATGAGAAGTCCTGAGG + Intronic
1018766231 6:166935151-166935173 CTAGGGTAGGCGAGGTCCTGTGG - Intronic
1027441041 7:78219503-78219525 CAGTAGTACGAGAGGCCCTGAGG - Intronic
1029049611 7:97670846-97670868 CTATAATGTGAGAGGTACTAGGG - Intergenic
1034254348 7:149716120-149716142 CTCCAGGTTGAGAGGTCCTGTGG + Intronic
1038463242 8:27734678-27734700 CTATAGTATGAGAGGTCCTGGGG - Exonic
1045006767 8:97922935-97922957 CTATTGTATGCCAGGGCCTGGGG - Intronic
1045713023 8:105008230-105008252 CTATATTTTGAGTGGTCCTGTGG - Intronic
1048036717 8:130684077-130684099 CTCTAGTGTGAGAGGTTCTCTGG - Intergenic
1052742418 9:32405879-32405901 ATAAAATATAAGAGGTCCTGAGG + Intronic
1058611332 9:106779448-106779470 AAATAGTAGGAGAGGTCATGGGG - Intergenic
1058851603 9:109016904-109016926 CTAGAGTATGAGAAGTCCTAAGG + Exonic
1058922345 9:109628862-109628884 TTATAGTATCAGAGGGCTTGGGG - Intergenic
1059695885 9:116729885-116729907 CTTTTGTATGAAAGGTCCTTTGG + Intronic
1059924970 9:119200205-119200227 CTATTGTGTGACAGGTCATGTGG + Intronic
1060857719 9:126928133-126928155 CTTTAATCTGAGAGGTCCAGTGG + Intronic
1060927599 9:127465789-127465811 CTCTGGGATGAGAGGGCCTGTGG + Intronic
1203619927 Un_KI270749v1:116246-116268 ATACAGTGTGAGAGTTCCTGGGG + Intergenic
1186974813 X:14890477-14890499 CTATAAAATGAGTGGTTCTGTGG - Intronic
1189699319 X:43700550-43700572 CTGTAGTCTGAGAGGTCCTCTGG + Intronic
1191246817 X:58234578-58234600 CTATATTATGAGAATGCCTGGGG - Intergenic
1196475021 X:116073538-116073560 CTATTGTATGGGAGGTCTGGTGG - Intergenic
1198614759 X:138444653-138444675 CTATAGCTTCAGAGATCCTGTGG - Intergenic