ID: 1038464058

View in Genome Browser
Species Human (GRCh38)
Location 8:27743602-27743624
Sequence ACCACACTTGTCCCCTGATA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 133
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 127}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1038464058_1038464067 20 Left 1038464058 8:27743602-27743624 CCATATCAGGGGACAAGTGTGGT 0: 1
1: 0
2: 0
3: 5
4: 127
Right 1038464067 8:27743645-27743667 GCACTTTGGGAGGCCAAGGCAGG 0: 56485
1: 171609
2: 226607
3: 184242
4: 115036
1038464058_1038464068 23 Left 1038464058 8:27743602-27743624 CCATATCAGGGGACAAGTGTGGT 0: 1
1: 0
2: 0
3: 5
4: 127
Right 1038464068 8:27743648-27743670 CTTTGGGAGGCCAAGGCAGGAGG 0: 25113
1: 73031
2: 147530
3: 156446
4: 127492
1038464058_1038464063 10 Left 1038464058 8:27743602-27743624 CCATATCAGGGGACAAGTGTGGT 0: 1
1: 0
2: 0
3: 5
4: 127
Right 1038464063 8:27743635-27743657 TTTAATCCCAGCACTTTGGGAGG 0: 1856
1: 319902
2: 268079
3: 146085
4: 131631
1038464058_1038464065 16 Left 1038464058 8:27743602-27743624 CCATATCAGGGGACAAGTGTGGT 0: 1
1: 0
2: 0
3: 5
4: 127
Right 1038464065 8:27743641-27743663 CCCAGCACTTTGGGAGGCCAAGG 0: 79234
1: 201556
2: 232767
3: 156913
4: 93134
1038464058_1038464060 6 Left 1038464058 8:27743602-27743624 CCATATCAGGGGACAAGTGTGGT 0: 1
1: 0
2: 0
3: 5
4: 127
Right 1038464060 8:27743631-27743653 TGCCTTTAATCCCAGCACTTTGG 0: 609
1: 102346
2: 241916
3: 242451
4: 213620
1038464058_1038464061 7 Left 1038464058 8:27743602-27743624 CCATATCAGGGGACAAGTGTGGT 0: 1
1: 0
2: 0
3: 5
4: 127
Right 1038464061 8:27743632-27743654 GCCTTTAATCCCAGCACTTTGGG 0: 1209
1: 239774
2: 278208
3: 178852
4: 139930

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1038464058 Original CRISPR ACCACACTTGTCCCCTGATA TGG (reversed) Intronic
902200627 1:14830855-14830877 TCCACATTTCTCCCTTGATATGG - Intronic
902215950 1:14934721-14934743 ACCACTCTGGTACCCTGATGGGG - Intronic
905834360 1:41104708-41104730 ACCCCTCTTGTCTCCTGAGAAGG - Intronic
907384367 1:54116523-54116545 ACCTCCCTTGCCCCTTGATAGGG - Intergenic
908158485 1:61382122-61382144 CCCAAATTTGTCCCCTGATGCGG + Intronic
910951633 1:92654090-92654112 CCCTGACTTGTCCCCTGCTAGGG + Intronic
914351789 1:146846262-146846284 ACCTCATTTATCCCCTGAAAAGG + Intergenic
917281472 1:173381277-173381299 ACAACACTTTTCCCCTAAGAAGG - Intergenic
917356457 1:174131311-174131333 GCCACACTTTTCCCCTGCTGGGG - Intergenic
919372179 1:196741574-196741596 TCCATACTTGCCACCTGATATGG - Intronic
923967131 1:239154513-239154535 ACCACACTTGTCCCCTCTGGGGG + Intergenic
924202251 1:241672384-241672406 GCCACACTTCTCCCCTGCTCTGG - Intronic
924369199 1:243329558-243329580 ACCTCTCTTTTCCCCTGAAATGG - Intronic
1063364204 10:5480028-5480050 ACCACAGCTGTCCCCTGCCACGG + Intergenic
1063364221 10:5480116-5480138 ACCACAGCTGTCCCCTGCCATGG + Intergenic
1063364231 10:5480160-5480182 ACCACAGCTGTCCCCTGCCACGG + Intergenic
1066493303 10:35916050-35916072 TCCTCATTTGTCCCCTAATAAGG - Intergenic
1067909474 10:50331674-50331696 ACCACTCTTGCCTCCTGCTATGG + Intronic
1068055378 10:52006244-52006266 ACCACACTTGTTCCCTAGCAAGG + Intronic
1075777865 10:124999636-124999658 ACCACACTGGTCCCTTGGCAGGG - Intronic
1077584629 11:3441284-3441306 ACCAGACATGGCCCCTGATTTGG - Intergenic
1078460542 11:11511835-11511857 ACCACACTGGTACCCTGATCTGG + Intronic
1080902981 11:36513077-36513099 ACCAAACTTGTCCCTTTATAAGG - Intronic
1081961146 11:47138410-47138432 CCAACCCTTGCCCCCTGATATGG - Intronic
1083972479 11:66088451-66088473 AAGACACATTTCCCCTGATACGG + Intronic
1084241530 11:67823938-67823960 ACCAGACATGGCCCCTGATTTGG - Intergenic
1084830910 11:71768698-71768720 ACCAGACATGGCCCCTGATTTGG + Intergenic
1086038166 11:82441974-82441996 ACCATAGTTGTCTCCTGCTAGGG - Intergenic
1086946852 11:92852333-92852355 ATCACATCTGTCCCCTGCTAAGG + Intronic
1091391217 12:127229-127251 ACCACGCCTGGCCCCTGATGAGG - Intronic
1092411785 12:8258577-8258599 ACCAGACATGGCCCCTGATTTGG - Intergenic
1093782793 12:23156079-23156101 ACCACCCCTGTCCCCTGAATGGG + Intergenic
1097029811 12:56082285-56082307 CCAACACTTCTCCCCAGATAAGG - Intronic
1097803107 12:63936971-63936993 ACCACATCTCTCCACTGATATGG - Intronic
1103518054 12:121520295-121520317 TCCACAAGTGTCCCCTGAAAAGG - Intronic
1110326602 13:74223483-74223505 ACCATACTTGTCCCATCATCTGG - Intergenic
1113887158 13:113667032-113667054 GCCTCACTTTTCCCCTGAGAAGG - Intergenic
1114191546 14:20443043-20443065 ACCACAGTTGTCCTCTGAGGTGG - Intergenic
1115851605 14:37594374-37594396 AGCACACTTCTCCCCAAATAGGG + Intronic
1116163464 14:41301678-41301700 AAGACACTGGTCCTCTGATAAGG - Intergenic
1123129547 14:105974251-105974273 AGCACACTTCTTCCCTGAGAAGG + Intergenic
1127111481 15:55676741-55676763 ACCACTCTTGTTCCCTATTATGG - Intronic
1129156676 15:73722462-73722484 ACCACACTTGTCACCAGACCTGG - Intergenic
1133353029 16:5114883-5114905 ACCAGACATGGCCCCTGATTTGG - Intergenic
1136507814 16:30717062-30717084 AGAACACTTGTGCCCTGCTAGGG - Intronic
1139738320 16:69012787-69012809 CACACATTTGTCCCCTGACAAGG - Intronic
1139982246 16:70869274-70869296 ACCTCATTTATCCCCTGAAAAGG - Intronic
1143989298 17:10943064-10943086 ACCACACTTGTCCCATATTCTGG - Intergenic
1144187427 17:12809662-12809684 ACCAGTCTTCTCCCCTGATATGG - Intronic
1145736230 17:27233659-27233681 ACCAACCTTCTCCTCTGATATGG - Intergenic
1147988612 17:44320316-44320338 ACCCCACCTGTCCCCTGCCACGG + Intronic
1153427038 18:4976100-4976122 TCCTCACTTCTCCCCTGATTTGG - Intergenic
1160802515 19:976903-976925 ACCACAGATGTCCCCAGACATGG - Intergenic
1161028424 19:2047212-2047234 ACCACAGATGTCCCCAGACATGG - Intronic
1161155184 19:2728856-2728878 ACCACAGATGTCCCCAGACATGG + Intronic
1161323154 19:3650456-3650478 ACCACAGATGTCCCCAGACATGG - Intronic
1161480310 19:4507062-4507084 ACCACAGATGTCCCCAGACATGG + Intronic
1161507322 19:4650827-4650849 ACCACACCTGGCCCCCGACAGGG - Intronic
1161523049 19:4736558-4736580 ACCACAAATGTCCCCAGACATGG - Intergenic
1163094760 19:15049000-15049022 ACCACACCTCACCCCTTATAGGG + Intergenic
1165526868 19:36363550-36363572 ACCAAAATTGTCTCCAGATATGG - Intronic
926317297 2:11720269-11720291 ACCAGACATGACCCATGATATGG + Intronic
927554028 2:24020127-24020149 ACCACACATGTCCCCAGCTCAGG - Intronic
927554497 2:24022558-24022580 ACCACACATGTCCCCAGCTCAGG - Intronic
928529697 2:32178382-32178404 ACCACACTTGGCCCGTGAACTGG - Intronic
933698165 2:85235728-85235750 ACCGCACCTGGCCCCTTATAAGG - Intronic
933839070 2:86271726-86271748 ACCTCATTTGCCCCCTGCTAAGG - Intronic
933885797 2:86719097-86719119 AGCTCACTTGTCCCCTTACAGGG - Intronic
936084424 2:109456709-109456731 TCCACATTTGTACCCTGAAAGGG - Intronic
939306343 2:140416364-140416386 ACCACTCCTGGCCTCTGATAGGG - Intronic
947166229 2:227264668-227264690 ACCACACCTGGCCCCAGAAAAGG - Intronic
947302352 2:228702233-228702255 ACCAAACTTGCTCCCTGTTATGG + Intergenic
1170520626 20:17180830-17180852 ACCACACTTGTTCCCAGCAATGG + Intergenic
1170917314 20:20639839-20639861 AGCAATCTTCTCCCCTGATATGG + Exonic
1171969265 20:31553391-31553413 ACCACACTTATCACCTGGGAAGG + Intronic
1172113638 20:32561510-32561532 ACCACACCTGTCCCCTGCTCTGG - Intronic
1173572411 20:44085967-44085989 CCCACACTTCTCACCTGGTACGG - Intergenic
1174150003 20:48479073-48479095 CCCAAACTTGTCCCCTGGTTGGG - Intergenic
1176689199 21:9883077-9883099 ACCACCCTTGCTGCCTGATATGG - Intergenic
1177135918 21:17305209-17305231 ACAACACTTTTCCCCTAAGAAGG - Intergenic
1183209023 22:36438767-36438789 ACCACCCTTGTTACCTTATATGG - Intergenic
1184994667 22:48196810-48196832 AACACACTCCTCCACTGATATGG + Intergenic
952201621 3:31134784-31134806 ACCTCCCTTGTCCCCTGACCTGG - Intergenic
961691727 3:128674792-128674814 AGAACACTGGCCCCCTGATAAGG + Intronic
961889325 3:130117246-130117268 ACCAGACATGGCCCCTGATTTGG - Intergenic
963110774 3:141686098-141686120 ATCACACTTGACCACTGAGAAGG - Intergenic
966226656 3:177605113-177605135 TCCTAACTTGTCCCCGGATAGGG + Intergenic
968405978 4:339106-339128 GCCACACTTGTCCCAGGACAGGG + Intronic
968999818 4:3971135-3971157 ACCAGACATGGCCCCTGATTTGG - Intergenic
969642582 4:8407873-8407895 ACCACCCGTGTCCCCTGGTGGGG - Intronic
969754189 4:9137500-9137522 ACCAGACATGGCCCCTGATTTGG + Intergenic
969814086 4:9673776-9673798 ACCAGACATGGCCCCTGATTTGG + Intergenic
975191160 4:71464202-71464224 ACCAGACTTCACCCCTGGTAAGG - Intronic
978876178 4:113642665-113642687 AGCATACTTCTCCTCTGATAAGG + Intronic
980352583 4:131700896-131700918 ACCACCCTTGCTGCCTGATATGG - Intergenic
982877548 4:160666860-160666882 ACAACACTTTTCCCCTAAGAAGG - Intergenic
986796619 5:11218932-11218954 ACCACAGCTGTCCCCTCATGTGG + Intronic
987574351 5:19706521-19706543 ATCACACATGTTCCCTGATTTGG + Intronic
992736858 5:79730409-79730431 ACCACATATGTCCCCTGAAGTGG + Exonic
993061594 5:83044910-83044932 TCCACACTTGTCCCCAAATGTGG - Intergenic
995561634 5:113388360-113388382 ATTACAATTATCCCCTGATATGG + Intronic
997705133 5:135943489-135943511 ACCACACCTGGCCCCTAATCAGG - Intronic
999611060 5:153370069-153370091 GCCAAACTTGTCCTTTGATAAGG - Intergenic
1000233684 5:159338099-159338121 TCCACCCTTGGCCCATGATAAGG + Intergenic
1000429782 5:161137414-161137436 CCCTGACTTGTCCCCTGAGATGG + Intergenic
1000889470 5:166785908-166785930 ACAGCACTTATCCCCTTATAAGG - Intergenic
1001198053 5:169691364-169691386 ACCTTCCTTGCCCCCTGATATGG - Intronic
1004065307 6:12238307-12238329 AGCACATTTGTGCCATGATAAGG + Intergenic
1006397612 6:33797286-33797308 TCCACACCTGTCCCCTCAAATGG + Intronic
1007205661 6:40148508-40148530 ACCCCACTTCTCCCCTCATCTGG - Intergenic
1012466716 6:99523536-99523558 CCCACTCTTCTCCCCAGATATGG + Intergenic
1016184545 6:141182866-141182888 ACAACACTTTTCCCCTCAGAAGG - Intergenic
1019985359 7:4651477-4651499 AGCAATCTTTTCCCCTGATAAGG + Intergenic
1021585047 7:22198946-22198968 ACCACAGATGTCCCCTAAGATGG + Intronic
1024053952 7:45647523-45647545 ACCTCACAAGTCCCCTGAAATGG - Intronic
1024639971 7:51320557-51320579 ACCATGCTTGTGTCCTGATATGG + Intergenic
1025952626 7:66157506-66157528 ACCACACCTGGCCCCAGACAAGG - Intergenic
1029586493 7:101475382-101475404 CCCACACTTTTCCCCTGACACGG - Intronic
1030763138 7:113376212-113376234 ACAGCATATGTCCCCTGATATGG - Intergenic
1032954393 7:136953826-136953848 ACCCCACTTGTCCTCAGAGAAGG + Intronic
1034139173 7:148800396-148800418 ACCACAAATCTCCCCTGATTCGG - Intronic
1038464058 8:27743602-27743624 ACCACACTTGTCCCCTGATATGG - Intronic
1048795003 8:138141566-138141588 CCCACACTTCTCCCCTGACTGGG - Intronic
1050503320 9:6321789-6321811 ACCACACTTAGCCCTGGATATGG + Intergenic
1053780128 9:41598819-41598841 ACCACCCTTGCTGCCTGATATGG + Intergenic
1054168068 9:61808976-61808998 ACCACCCTTGCTGCCTGATATGG + Intergenic
1054669460 9:67771842-67771864 ACCACCCTTGCTGCCTGATATGG - Intergenic
1056692225 9:88817487-88817509 ACCACACTTGGCACCTGGCAAGG - Intergenic
1060203291 9:121665746-121665768 ACCACACTTATTCCCATATAAGG - Intronic
1192873563 X:75206951-75206973 ACCACACTTGGCCAATGATGGGG + Intergenic
1193797943 X:85899306-85899328 TCCACACATGTCCCCGGTTATGG - Intronic
1200776813 Y:7176789-7176811 ACAACACTTTTCCCCTAAGAAGG - Intergenic
1201468968 Y:14313830-14313852 ACAACACTTTTCCCCTAAGAAGG - Intergenic