ID: 1038466993

View in Genome Browser
Species Human (GRCh38)
Location 8:27773395-27773417
Sequence AGGTTTTTAAAGACGAAGAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 485
Summary {0: 1, 1: 1, 2: 0, 3: 39, 4: 444}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1038466993_1038466998 21 Left 1038466993 8:27773395-27773417 CCCTTCTTCGTCTTTAAAAACCT 0: 1
1: 1
2: 0
3: 39
4: 444
Right 1038466998 8:27773439-27773461 GAGCTCATATCCAAGCCTGCTGG No data
1038466993_1038467000 27 Left 1038466993 8:27773395-27773417 CCCTTCTTCGTCTTTAAAAACCT 0: 1
1: 1
2: 0
3: 39
4: 444
Right 1038467000 8:27773445-27773467 ATATCCAAGCCTGCTGGTGGAGG No data
1038466993_1038466995 -9 Left 1038466993 8:27773395-27773417 CCCTTCTTCGTCTTTAAAAACCT 0: 1
1: 1
2: 0
3: 39
4: 444
Right 1038466995 8:27773409-27773431 TAAAAACCTGCTTGTAGCAAAGG No data
1038466993_1038466999 24 Left 1038466993 8:27773395-27773417 CCCTTCTTCGTCTTTAAAAACCT 0: 1
1: 1
2: 0
3: 39
4: 444
Right 1038466999 8:27773442-27773464 CTCATATCCAAGCCTGCTGGTGG No data
1038466993_1038467001 28 Left 1038466993 8:27773395-27773417 CCCTTCTTCGTCTTTAAAAACCT 0: 1
1: 1
2: 0
3: 39
4: 444
Right 1038467001 8:27773446-27773468 TATCCAAGCCTGCTGGTGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1038466993 Original CRISPR AGGTTTTTAAAGACGAAGAA GGG (reversed) Intronic
900084528 1:884935-884957 AGGTATTTAAATAGGAAGAGAGG - Intergenic
903388266 1:22944273-22944295 AGACTTTAAAAGAAGAAGAAAGG + Intergenic
904660282 1:32078947-32078969 AGTTTTTTAAAAAAGAAAAATGG + Intronic
906365172 1:45203876-45203898 TGGATTTCAAAGACGAAGACCGG - Intronic
908445827 1:64198767-64198789 AGATTTAAAAAGAGGAAGAAAGG + Intergenic
908935526 1:69371728-69371750 AGATTTAAAAAGACAAAGAATGG - Intergenic
909485818 1:76172514-76172536 AGGTATTCAAATAGGAAGAAAGG + Intronic
909818461 1:80027557-80027579 AGGTTTTTAAAGGCACAGGATGG - Intergenic
909932880 1:81518074-81518096 AGGTTTTTAGCGAGGAAGGATGG + Intronic
910653343 1:89593429-89593451 AAGTTAATAAAGATGAAGAATGG + Exonic
910812941 1:91256265-91256287 AGATTTAAAAAGACAAAGAAGGG + Intergenic
910822112 1:91362220-91362242 AGGTATTTAAATAGGAAGAGAGG + Intronic
910914753 1:92277116-92277138 ATAGTTTTAAAGATGAAGAAAGG - Intronic
911187910 1:94921789-94921811 AGAATTTTAAAGAGGAAGCATGG + Intronic
911311386 1:96296223-96296245 AGGTCATAAAAGACAAAGAAGGG - Intergenic
911341196 1:96640609-96640631 AAGTTTTTAGAGAAGAATAATGG - Intergenic
911441085 1:97926378-97926400 AGTTTTTTAAAGTAGAAGAATGG + Intergenic
911450734 1:98057185-98057207 AGATTTTTAGACCCGAAGAAGGG + Intergenic
911667446 1:100569497-100569519 TGGTTTTAAAAAACAAAGAAAGG + Intergenic
911909320 1:103612632-103612654 ATGTTTTTCAAGACGAATAGAGG + Intergenic
912837807 1:113011614-113011636 AGGTTGTGAAAGACGAAGTGTGG + Intergenic
913065137 1:115244687-115244709 AGACTTTTAAAGAGGAACAATGG + Intergenic
914003370 1:143711383-143711405 AGGTTTGTAAAGACCAAAAAGGG + Intergenic
914094587 1:144533879-144533901 AGGTTTGTAAAGACCAAAAAGGG + Intergenic
914303933 1:146400002-146400024 AGGTTTGTAAAGACCAAAAAGGG - Intergenic
914312639 1:146480192-146480214 AGGTTTCTAAAGACCAAAAAGGG + Intergenic
914501709 1:148253146-148253168 AGGTTTCTAAAGACCAAAAAGGG - Intergenic
914502704 1:148261522-148261544 AGGTTTTTAAAGGTCAAAAAGGG - Intergenic
914515808 1:148373182-148373204 AGGTTTGTAAAGACCAAAAAGGG + Intergenic
914702102 1:150144051-150144073 AAGGTTTTAAAGCAGAAGAAGGG + Intronic
915642498 1:157239839-157239861 AGCTTTTTAAAGGCAAAGCAGGG - Intergenic
916354016 1:163884224-163884246 AGGTTTTCAAACAAGAAAAAGGG - Intergenic
916449500 1:164906620-164906642 AGGGGTTTAAAGATGAAGAAGGG + Intergenic
916676412 1:167067400-167067422 ACTTTTTTAAAAAAGAAGAAGGG - Intronic
916847299 1:168665391-168665413 AGGTTTTTGAAGACCAGGCATGG - Intergenic
916960830 1:169887164-169887186 AGGTTTTCAAAGCCACAGAATGG + Intronic
918683162 1:187380382-187380404 AGATTTGAAAAGAAGAAGAAAGG - Intergenic
918778357 1:188666666-188666688 AGGCTTTTAAACAGGCAGAATGG - Intergenic
919077238 1:192828573-192828595 GGGTTTTCAAATAGGAAGAAAGG + Intergenic
919220881 1:194626811-194626833 AGATTATAAAAGACAAAGAAGGG + Intergenic
920411011 1:205760841-205760863 TGGCTTTTGAAGATGAAGAAAGG + Intergenic
921524476 1:216200725-216200747 AGGTTTTTAAAAAATAAGATAGG + Intronic
921881234 1:220256637-220256659 AGATTTAAAAAGACAAAGAAGGG + Intronic
922572194 1:226640764-226640786 TGGTTTCAAAAGACAAAGAAGGG + Intronic
923489845 1:234475040-234475062 AAGTTTTTAAAGACCAAGGTGGG + Intronic
924126928 1:240864526-240864548 AGGTTGATAAAGACAAAGAAAGG + Intronic
924764461 1:247019485-247019507 AGGTATTTAAATAGGAAGATAGG + Intergenic
1064141869 10:12797533-12797555 TGGTCTTTAAAGCAGAAGAAAGG - Intronic
1065593058 10:27285184-27285206 AGGTTTTTCAAGATGATGATGGG - Intergenic
1065657314 10:27965096-27965118 AGGTTTTTCAAGATGATGATGGG + Intronic
1068516634 10:58033309-58033331 AGGTATTCAAATAGGAAGAAAGG - Intergenic
1069965902 10:72116225-72116247 AGGTTTTTAAAAAAGAAGGAAGG - Intronic
1071971965 10:90916492-90916514 ATGTTTTAAAAGAATAAGAATGG + Intronic
1072018483 10:91374556-91374578 AGAGTTTTGAAGAAGAAGAAAGG - Intergenic
1076862455 10:133145357-133145379 AGGTTTTTAAAAGCAAAAAAGGG - Intergenic
1078075915 11:8160377-8160399 AGTTTTTTAAAAATCAAGAATGG + Intronic
1078853301 11:15183984-15184006 ATGTATTTAAAGAAAAAGAAAGG - Intronic
1079439774 11:20499640-20499662 ATTTTTTTAAAGAAGAAGATGGG + Intronic
1079685433 11:23353296-23353318 AGGTTCTGAAAGACAATGAAGGG - Intergenic
1079835429 11:25327606-25327628 AGGTATTAAAGGACTAAGAATGG + Intergenic
1081965627 11:47167477-47167499 AGGGTTTTAAAAAATAAGAAGGG + Intronic
1082035043 11:47638571-47638593 GTGTTTTTCAAGAGGAAGAAAGG + Intronic
1082185770 11:49179128-49179150 TGGATTTTAAAGATGAATAAGGG + Intronic
1082717442 11:56632015-56632037 AGGTCTTTCAGGAAGAAGAATGG + Intergenic
1082876040 11:57990182-57990204 AGATTTAAAAAGACAAAGAAGGG - Intergenic
1082955531 11:58866164-58866186 AAGCTTTTACAGAGGAAGAAAGG - Intronic
1082962998 11:58936943-58936965 AAGCTTTTAGAGAGGAAGAAGGG - Intronic
1083085885 11:60144861-60144883 ATTTTTTTAAAGACTAAGAGAGG - Intergenic
1083774275 11:64886022-64886044 AGGTCTTGAAAAACAAAGAAAGG + Intronic
1084519765 11:69656072-69656094 AGGTTTTTTAAGATGAAAGAGGG + Intronic
1084789721 11:71466134-71466156 AGGTTTTTAAAAATTGAGAATGG + Intronic
1085612773 11:77967794-77967816 AGGTAATGAAAGACAAAGAAAGG + Intronic
1085871658 11:80357444-80357466 AGCTCTTTAAAGACCAAAAAAGG + Intergenic
1086011240 11:82105910-82105932 AGGTTTTTAGAGCAGAATAAAGG - Intergenic
1086680554 11:89666247-89666269 TGGATTTTAAAGATGAATAAGGG - Intergenic
1086741692 11:90377466-90377488 AGATTTAAAAAGACAAAGAAGGG - Intergenic
1087306140 11:96491131-96491153 AGGTATTCAAATAGGAAGAAAGG + Intronic
1087601644 11:100324194-100324216 AGATTTTTAAAGGCAAAGAAAGG + Intronic
1087879677 11:103401466-103401488 AGGTCTCTAAAGCCAAAGAAAGG + Intronic
1088495410 11:110427039-110427061 AAGATTTTAAAGAAAAAGAAGGG + Intergenic
1088752625 11:112857301-112857323 AGGTCTTTAAAGTCAAAGGAAGG + Intergenic
1089277390 11:117346910-117346932 AGGTGGGTAAAGAAGAAGAAGGG - Intronic
1091265400 11:134267013-134267035 AGGTTTTTAATGCGGAAGATAGG + Intergenic
1091819228 12:3462349-3462371 AGGTTTTTAAAGGCAAAAGAAGG + Intronic
1092087940 12:5779850-5779872 ATGTCATGAAAGACGAAGAAAGG + Intronic
1092308694 12:7328339-7328361 ACGTTTTAAGAGACCAAGAATGG + Exonic
1092442937 12:8525453-8525475 AGGTTAAAAAAGACAAAGAATGG - Intergenic
1092531139 12:9346627-9346649 AGGTTTTTAAAGACAAAAGGGGG - Intergenic
1092611615 12:10178979-10179001 AGGGTTTCAAAGAGCAAGAAGGG + Intronic
1093170011 12:15849750-15849772 AGGTTTTGAAAAAGGAAGGAAGG + Intronic
1093844650 12:23954628-23954650 AGGTCTTTAAAAAAGAAGATAGG - Intergenic
1094505522 12:31057677-31057699 GGTTTTTTAAAAAGGAAGAAGGG - Intergenic
1094811709 12:34144619-34144641 AGGTATTTAAATAGGAAGAAAGG + Intergenic
1095496709 12:42792353-42792375 TGTTTTTTAAAAAAGAAGAATGG - Intergenic
1096225234 12:49862013-49862035 AGCTGTTTAAACACAAAGAAAGG + Intergenic
1096376036 12:51111521-51111543 AACTTTTTAAAGAGGAAAAAAGG - Intronic
1096906743 12:54943245-54943267 AGGTATTAAAGGACTAAGAATGG + Intergenic
1097689347 12:62719833-62719855 GGGTTATTAAAGAGGTAGAATGG - Intronic
1097917551 12:65036742-65036764 CAGTTTTAAAAGATGAAGAAGGG - Intergenic
1098641492 12:72843508-72843530 AGGTATTTAAATATGAAGAGAGG + Intergenic
1098763480 12:74454376-74454398 AAGTTCTTAAAAAGGAAGAAAGG - Intergenic
1099039991 12:77640894-77640916 AGGTTTTTAAATGCAAAGAGAGG + Intergenic
1099065329 12:77970177-77970199 ATATTTTCAAAGACGATGAAAGG - Intronic
1099480796 12:83163542-83163564 ATGGTTTTAAAAACAAAGAATGG - Intergenic
1099569313 12:84295595-84295617 AGCTTTTTGAAGATAAAGAATGG - Intergenic
1099880396 12:88460484-88460506 AGGTCATTAAAGTCAAAGAAAGG + Intergenic
1100115329 12:91296586-91296608 AGATTTAAAAAGACAAAGAAGGG + Intergenic
1101262302 12:103045525-103045547 ACCTTTTTAAAGCTGAAGAATGG - Intergenic
1101363994 12:104054763-104054785 TGGATTTTAAACAGGAAGAAAGG - Intronic
1102032317 12:109748069-109748091 AGGATTTTAAAAATCAAGAATGG + Intronic
1104624642 12:130340974-130340996 AGGTTTTTAAAATTGAAAAATGG + Intronic
1104839325 12:131813871-131813893 AGATTTTTAGAAACAAAGAAGGG - Intergenic
1105308128 13:19183129-19183151 GGGTTTTTAAAGGAAAAGAAGGG + Intronic
1105672299 13:22633019-22633041 GGGTATTTAAATAGGAAGAAAGG - Intergenic
1106905491 13:34404999-34405021 TGGTTCTTAAAGACAAGGAAGGG - Intergenic
1107508233 13:41057091-41057113 TGGTATTTAAAGAAGTAGAAGGG - Intronic
1108843445 13:54650108-54650130 AATTTTTTAAAGAAAAAGAATGG - Intergenic
1108931261 13:55824934-55824956 AGGATCTTAATGACCAAGAAAGG + Intergenic
1109054647 13:57532171-57532193 AGGTTTTTACAGAGAAAGAGAGG + Intergenic
1109170461 13:59090127-59090149 AGGTTGAGAAAGACAAAGAAAGG - Intergenic
1109550062 13:63883990-63884012 AGGTTTTTAGATAAGAATAAGGG - Intergenic
1109715459 13:66216135-66216157 AAGTTTTTAGAGAAGCAGAATGG - Intergenic
1110159014 13:72352982-72353004 AGGTTTTTATAGGCACAGAATGG + Intergenic
1110596188 13:77323138-77323160 AGTTTTTTAAATATGTAGAATGG - Intronic
1112149173 13:96737938-96737960 AGGTTCTTATACATGAAGAAGGG - Intronic
1112310229 13:98311653-98311675 AGATTTTTAAAGTGTAAGAAAGG - Intronic
1113102918 13:106739793-106739815 ATTTTTTTTAAGAAGAAGAAAGG + Intergenic
1113333074 13:109350380-109350402 AGATTTTTAGAGACGTATAAAGG + Intergenic
1114413461 14:22521854-22521876 GGGATTGTAAAGACGAAGGAGGG + Intergenic
1114741958 14:25106395-25106417 AGGTATTCAAAGATGAAGAGAGG + Intergenic
1114785473 14:25592483-25592505 AGGTATTTAAATAGGAAGCAAGG - Intergenic
1115295197 14:31818053-31818075 AGATTTAAAAAGACAAAGAAGGG + Intronic
1115453022 14:33570559-33570581 GGGTTTGCAAAGACCAAGAAAGG + Intronic
1116648740 14:47563496-47563518 ATTTTTTTAAAGGTGAAGAAGGG - Intronic
1118030140 14:61811438-61811460 AGTTTTTAAAAGAAGAAAAAAGG - Intergenic
1118069169 14:62226376-62226398 AAGTTTTTAAAGACACAGACTGG - Intergenic
1119009247 14:70966657-70966679 AGATTGTTAAAGAAGGAGAAAGG + Intronic
1120078130 14:80183422-80183444 ATGTTTTTCAAGAAGAAAAAAGG + Intergenic
1120854106 14:89197818-89197840 AGTGTTTGAAAGGCGAAGAACGG + Intronic
1121044813 14:90780034-90780056 AGGATTTTAATTACCAAGAAAGG + Intronic
1122031214 14:98914080-98914102 AGGATGTAAAAGAGGAAGAAAGG + Intergenic
1123551044 15:21382250-21382272 ATATTTTAAAAGACGCAGAAGGG - Intergenic
1125191646 15:37000751-37000773 ACGTTTGTAAACAAGAAGAAAGG - Intronic
1126173098 15:45710642-45710664 AGGTTATAAAAGACAAAGAAAGG - Intergenic
1127108624 15:55644465-55644487 ATTTTTTTAAAAAGGAAGAAGGG - Intronic
1130430405 15:83841818-83841840 GGGTTTTTATAGACACAGAATGG - Intronic
1130724263 15:86421835-86421857 AGATTTAAAAAGACAAAGAAGGG + Intronic
1131502576 15:92983243-92983265 AGGTTTTTATTGCTGAAGAAAGG - Intronic
1132043138 15:98542087-98542109 ATGTTTTAAAAGACTATGAAAGG + Intergenic
1132256884 15:100383894-100383916 AGGTTTTTAAAGAGAGAGAGGGG - Intergenic
1202959387 15_KI270727v1_random:109493-109515 ATATTTTAAAAGACGCAGAAGGG - Intergenic
1132772849 16:1574157-1574179 AGGTTTTTAAGGCCGAAAAGAGG - Intronic
1133354176 16:5123848-5123870 GGGTTTTTATAGGCGCAGAATGG + Intergenic
1134343947 16:13371973-13371995 AGCTTTACAAAGAAGAAGAAAGG - Intergenic
1135243588 16:20834034-20834056 AGGTTATGAAAGACAAAGAAAGG - Intronic
1135794819 16:25431743-25431765 ATGTTTTTATAGACGCTGAAAGG + Intergenic
1138909807 16:61382843-61382865 AGGTTTTTAAATAAGAAAACTGG - Intergenic
1139173279 16:64657370-64657392 AGATTGGTAAAGATGAAGAAGGG - Intergenic
1139554325 16:67696979-67697001 AGGATGTTAAAGACAAAGAGTGG - Intronic
1140441088 16:74988459-74988481 GGGTTTCTAAAGAAAAAGAAGGG - Intronic
1141014623 16:80437462-80437484 AGGTTCTTAAAAACGGAAAAAGG + Intergenic
1141767283 16:86066992-86067014 AGGTTTTTATAGACACAGGAAGG + Intergenic
1142756828 17:2021418-2021440 AGGGTTTGAAAGATGAAGAAAGG - Intronic
1143661254 17:8325900-8325922 AGGTTTTCAAAGGCAAAAAAGGG + Intergenic
1143827480 17:9622375-9622397 AGTTTTGTAAAGATGAGGAAGGG - Intronic
1143907570 17:10221510-10221532 AGATTTTTAATGCTGAAGAATGG - Intergenic
1143931931 17:10438183-10438205 AGATTTTTAAAGCCCAACAAAGG - Intergenic
1144218486 17:13078967-13078989 CTGTTTTTCAAGAGGAAGAAAGG - Intergenic
1144712123 17:17408555-17408577 AGGTCATGAAAGACAAAGAAAGG - Intergenic
1145744078 17:27300576-27300598 TGGTTTTTAAGGACAAAAAATGG - Intronic
1146429441 17:32777343-32777365 AGTTTTATAAATAGGAAGAAAGG - Intronic
1147235572 17:39055056-39055078 GGGTTTTTAAAGACTGGGAAGGG + Intergenic
1148948494 17:51287323-51287345 AGCTTTTAGAAGAGGAAGAAAGG + Intronic
1149062615 17:52440939-52440961 AGGTGTCTAAATAGGAAGAAAGG + Intergenic
1149218631 17:54389036-54389058 GGGTTTTTATGGACAAAGAAAGG - Intergenic
1149241933 17:54661277-54661299 AGATTTAAAAAGACAAAGAAAGG - Intergenic
1150538538 17:66072456-66072478 AGGTCACTAAACACGAAGAAAGG - Intronic
1150718282 17:67591244-67591266 AGGTCATGAAAGACAAAGAAAGG + Intronic
1150961128 17:69913525-69913547 AGTGTTTTAAAGAGGAAGACTGG + Intergenic
1152144021 17:78556832-78556854 ACGTTTAAAAAGAAGAAGAATGG + Intronic
1154451946 18:14485676-14485698 ATTTTTTAAAAGACGCAGAAGGG - Intergenic
1155545225 18:26907615-26907637 AGGTCCTTAAAGAGGAATAAAGG + Exonic
1155603023 18:27571163-27571185 TGGATTTTAAATATGAAGAAAGG - Intergenic
1159337141 18:67083043-67083065 ATGTTATTAAAGACAGAGAAAGG - Intergenic
1165021519 19:32928221-32928243 AGATTTTAAAAGACTAAAAAGGG - Intronic
1167293788 19:48637923-48637945 AGGTTTAGAAAGAGGAAGATTGG + Exonic
925467950 2:4126786-4126808 TTATTTTTAAAGATGAAGAAAGG + Intergenic
925692370 2:6538111-6538133 AGGAATCTAAAGACGAAGACTGG - Intergenic
926511819 2:13790878-13790900 GGGTTTTTAATGATGAAAAATGG + Intergenic
927390710 2:22591663-22591685 AGATTTAAAAAGACAAAGAAGGG + Intergenic
927892501 2:26760700-26760722 AGGTTTTTAAAGGCAGAAAAAGG + Intergenic
929361193 2:41093182-41093204 AGGTATTCAAATAGGAAGAAAGG + Intergenic
929868659 2:45739529-45739551 AGGTTTTTAAAAAGGAAGGGAGG - Intronic
930010703 2:46936302-46936324 AAGTTTTTAGAGAAGAAGATAGG + Intronic
930160206 2:48147070-48147092 AGAATATTAAAGAAGAAGAAAGG + Intergenic
930354433 2:50299923-50299945 AGGTGATTAAAGAGGAACAAAGG + Intronic
930981851 2:57535073-57535095 AGATTTTTAAAGGCAAAAAACGG + Intergenic
931399477 2:61917427-61917449 AGTTTTTTAAAATCAAAGAATGG + Intronic
931656662 2:64515440-64515462 AGGATTTTAAAGATGTAGAAAGG - Intergenic
932608386 2:73179501-73179523 TGGTTTTAAAAAAAGAAGAAAGG + Intergenic
933502605 2:83134245-83134267 AATTTTTTAAAGTGGAAGAAAGG + Intergenic
934058770 2:88274754-88274776 AGGTTTTTAAAAGAAAAGAAGGG + Intergenic
935567568 2:104625681-104625703 AGGTATTTAAATAGGAAGAGAGG - Intergenic
935936216 2:108186064-108186086 AGATTTTTAAATTGGAAGAAAGG + Intergenic
936237797 2:110759433-110759455 AGATTATAAAAGACAAAGAAGGG - Intronic
936436803 2:112514945-112514967 AGGTTTTAATAGATAAAGAAAGG - Intronic
936461514 2:112717847-112717869 ATGTCGTTAAAGACAAAGAAAGG - Intergenic
936485471 2:112921832-112921854 AGATTTTTATAAATGAAGAAAGG + Intergenic
936553105 2:113467760-113467782 AGGTTTTTACAGATGGAGTAGGG + Intronic
936582279 2:113711883-113711905 ATGTTTTTAAAGAAGGATAAAGG - Intronic
936608648 2:113980388-113980410 AGGTTTTCAAAGAGAAAGTAAGG + Intergenic
940971145 2:159898278-159898300 AAGTTTTAAAAGAAGAAGAAAGG - Intronic
942456612 2:176142532-176142554 AGATTTTAAAAGACTAAGGAGGG - Intergenic
942465071 2:176198979-176199001 AGGTTTTTATAGACCCACAATGG - Intergenic
942599219 2:177623047-177623069 AGCTTTTTAAAGATGACAAAAGG - Intergenic
942899010 2:181091598-181091620 AGATTTAAAAAGACAAAGAAGGG + Intergenic
942906143 2:181183174-181183196 ACGTTTTTAAAGATGAATACTGG - Intergenic
943351099 2:186797150-186797172 AGGTATTTAAATAGGAAGAGAGG + Intergenic
943909854 2:193549585-193549607 AGGTTATTAAAGAAAAAAAAAGG + Intergenic
944743329 2:202633505-202633527 AGGCTTTTAAAGACCTAGAGAGG - Intergenic
945832937 2:214808638-214808660 AGGTTTGTAAAACCCAAGAAAGG - Intronic
946789222 2:223283906-223283928 AGGTTTTTTAAGGCAAAAAAGGG - Intergenic
947688104 2:232108579-232108601 AGGTATTTAAATAGGAAGAGAGG + Intronic
948329443 2:237153438-237153460 TGCTCTTTGAAGACGAAGAAGGG - Intergenic
948764906 2:240214482-240214504 AGGTTTTTAAAGACGAAAAAGGG + Intergenic
1168991520 20:2100346-2100368 AGGTCATGAAAGACAAAGAAAGG + Intergenic
1169675264 20:8145895-8145917 AAGATTTCAAAGACTAAGAATGG - Intronic
1170035907 20:11989589-11989611 AGGTTTTCAAAAACAAAGAATGG + Intergenic
1170520726 20:17182117-17182139 AGATTGATAAAGACAAAGAAGGG + Intergenic
1173074044 20:39799447-39799469 AGTTTATAAAAGACAAAGAAAGG - Intergenic
1173348609 20:42223998-42224020 ATGTTTTTTAAGTGGAAGAATGG - Intronic
1173652212 20:44673594-44673616 AGCATTTTAAAGATCAAGAATGG - Intergenic
1174355233 20:49993318-49993340 ATGTTGTGAAAGACAAAGAAAGG - Intergenic
1175181406 20:57150476-57150498 AGGTTTTTAAAGGGAAATAAGGG + Intergenic
1176444075 21:6802624-6802646 ATTTTTTAAAAGACGCAGAAGGG + Intergenic
1176822242 21:13667663-13667685 ATTTTTTAAAAGACGCAGAAGGG + Intergenic
1178196468 21:30350443-30350465 AAGTTTTTAAATACAAAGAGAGG - Intronic
1178380913 21:32107213-32107235 TGGTTTTTAAGGACTTAGAATGG - Intergenic
1178564290 21:33668863-33668885 AGGTTTTCAAAGAAGCAGGACGG - Intronic
1178634866 21:34293326-34293348 AGGTTTTCAAAGAAGAAAACGGG - Intergenic
1179516406 21:41911114-41911136 AAGTTTTTAAAAATTAAGAATGG + Intronic
1179651613 21:42813172-42813194 AAGATTTTAAAGACGAAAAGGGG - Intergenic
1179795755 21:43782212-43782234 AGGTTTTTAAAGACAAAAGGGGG - Intergenic
1180080488 21:45485514-45485536 AGATTTTTAAAGACGATAAAAGG + Intronic
1180969774 22:19809140-19809162 GGGTTTTTAAAGGCACAGAATGG - Intronic
1182390919 22:29995283-29995305 AGATTTTCAAATACGGAGAAAGG - Intronic
1183800377 22:40158488-40158510 AGGTTTTTAAAGATAAAGACTGG - Intronic
1185027334 22:48422991-48423013 GGGTTTTGGAAGACCAAGAAGGG + Intergenic
950445305 3:13034044-13034066 AGGTCTTTAAAGAGGAATGAAGG - Intronic
951179924 3:19647569-19647591 AGGTTGTTACAGCAGAAGAAGGG - Intergenic
952754546 3:36855065-36855087 AGGTTTTTACAGCTGAAGTAAGG - Intronic
953523266 3:43663567-43663589 AGGTTTTCAAATAGGAAGAGTGG + Intronic
953772194 3:45786392-45786414 AGGTCATGAAAGACAAAGAAAGG - Intronic
953816322 3:46161041-46161063 AGATTTAAAAAGACAAAGAAGGG - Intergenic
954445584 3:50545090-50545112 ATGTTTTTTAAAAGGAAGAAGGG + Intergenic
955075357 3:55608265-55608287 GCGTTTTTAGAGACAAAGAAAGG + Intronic
956386645 3:68726146-68726168 ATCTTTTTAAAGAAGAGGAATGG + Intergenic
957564570 3:81867151-81867173 AGCTTTTTAAAGAAGAAAATGGG + Intergenic
958043464 3:88253998-88254020 AAGTTTTTAAAGACAAAAAGAGG - Intergenic
960009291 3:112815950-112815972 AGTTCTTTAAAGAAGAAGGAAGG - Exonic
961220809 3:125198281-125198303 AGGTCATAAAAGACAAAGAAAGG + Intronic
961243057 3:125429094-125429116 AGGCTTTTAAAGGCAAAAAAAGG + Intergenic
961684899 3:128623101-128623123 AGGTTATTAAACACAAAGAAAGG + Intronic
962064761 3:131967400-131967422 GGGTATTTAAATAGGAAGAAAGG + Intronic
962109926 3:132433900-132433922 AGGTTTTTAAAGACGGGGACTGG - Intronic
962117504 3:132527254-132527276 ATGGTTTTTAAGATGAAGAATGG - Intronic
962663655 3:137631556-137631578 TGGTTTTTAAAAACAGAGAAGGG + Intergenic
962884072 3:139607332-139607354 AGGTTTCTTAAGTTGAAGAAAGG - Intronic
965535748 3:169822321-169822343 AGGTTTTTAAAGATGACGACGGG - Exonic
966508679 3:180736137-180736159 AGGTTCTCAAAGACGAACAGAGG - Intronic
967403914 3:189095270-189095292 AGGTTTCTAATGATGAACAAAGG + Intronic
967901655 3:194460288-194460310 GGGTTTTTAAAAAAGAAAAAAGG + Intronic
967910131 3:194535791-194535813 AGGCTTTTAAAGACTCAGGAAGG + Intergenic
968358826 3:198132140-198132162 AGGTATTTAAATAGGAAGAGAGG - Intergenic
969887141 4:10225123-10225145 GGGTGTTAAAAGAGGAAGAAAGG - Intergenic
969903392 4:10370826-10370848 AGGTTTTTAAATAGCAGGAATGG + Intergenic
970083558 4:12319116-12319138 AGGTTTTTACTCATGAAGAATGG - Intergenic
970825186 4:20263682-20263704 AAGTTTTGAAAGATGAAGCAAGG - Intronic
971103564 4:23497089-23497111 AGGTACTTACAGATGAAGAAGGG + Intergenic
971195077 4:24465316-24465338 ATGTTTTAAAAAAAGAAGAAAGG - Intergenic
971859414 4:32085722-32085744 AGGTTTTTATGGACTCAGAATGG + Intergenic
972269851 4:37500870-37500892 AGATTTAAAAAGACAAAGAAGGG - Intronic
974390779 4:61264531-61264553 TGATTTTTAAAAAGGAAGAAAGG - Intronic
974410476 4:61535130-61535152 GGGTTTTTTAAAACCAAGAAGGG + Intronic
974770642 4:66407038-66407060 GGGTTTTTAAGGGCAAAGAATGG + Intergenic
975178555 4:71315696-71315718 AAGTCTTTAAAGACAAAGTATGG + Intronic
975659892 4:76678052-76678074 AGGTTTTTAGAGAATAAGAGAGG + Intronic
975998480 4:80343060-80343082 AGATTTAAAAAGACAAAGAAGGG + Intronic
976649601 4:87420871-87420893 AGGTTTTTAAAGGCAAAAAGGGG - Intergenic
977188268 4:93967956-93967978 AGGTCTTAAAAGACAATGAAAGG - Intergenic
978948340 4:114525928-114525950 AGGTATTCAAAGAGGAAGAGAGG - Intergenic
979728673 4:123995312-123995334 AGGTTTTAAAAGGCGGGGAAGGG + Intergenic
979927005 4:126580388-126580410 AGGTTGTTAATGAAGAAAAAGGG - Intergenic
979968736 4:127108219-127108241 AGATTATAAAAGACAAAGAAGGG + Intergenic
980024857 4:127753368-127753390 AGATTTTTAAAAACTAAGAGTGG + Intronic
980529420 4:134032250-134032272 TGTTTTTTAAAGGGGAAGAATGG - Intergenic
980813119 4:137909612-137909634 TAGTTTTTAAAGAGGAATAATGG - Intergenic
982035849 4:151345038-151345060 AGTTTTTTAAAAAGGAATAAAGG - Intergenic
982420565 4:155191642-155191664 AGGATTTGAAAGATGAATAAGGG - Intergenic
982777163 4:159453678-159453700 AAGTTTTTAAAAAAGAATAATGG - Intergenic
982820376 4:159937447-159937469 AGCTTTTTAAAGATGAAGGCTGG - Intergenic
983111759 4:163758926-163758948 AGGTTTTTAAATATTAGGAAAGG + Intronic
983169265 4:164517554-164517576 AGGTATTCAAATAGGAAGAAAGG - Intergenic
983524403 4:168746095-168746117 AGGTTGTGAAAGACGAGAAAAGG - Intronic
983559317 4:169085347-169085369 GGGTTTATAAAGAAGAAAAATGG - Intergenic
984313048 4:178088560-178088582 AGGGTTTTAAGGGCAAAGAAGGG - Intergenic
984356818 4:178670687-178670709 AAGATTTTAAAGTTGAAGAAAGG - Intergenic
985174002 4:187181884-187181906 ATGTTTTTAAGGTCTAAGAAAGG + Intergenic
985393407 4:189515166-189515188 GGGTTTTTAAAGGCAATGAACGG + Intergenic
986205107 5:5616664-5616686 AGGTCTTTAAAGACGGAAGACGG + Intergenic
986299678 5:6468100-6468122 AGGTTTATAGAGACGGTGAAAGG - Intronic
986886867 5:12249254-12249276 AAATTTTTAAAGACAAAAAAGGG - Intergenic
987776097 5:22368827-22368849 ATGTTTTTAAAAAGGAATAAAGG - Intronic
987957027 5:24753548-24753570 AGGTTAAAAAAGACAAAGAAGGG - Intergenic
988122745 5:26988843-26988865 AGGATTGTAAAGAGGAAGATAGG - Intronic
988134058 5:27146323-27146345 AGGATTTTAAAATGGAAGAAAGG + Intergenic
988294361 5:29335765-29335787 AGGTATTCAAATAGGAAGAAAGG + Intergenic
989202424 5:38777165-38777187 AGATTTTTAAAAATGAACAAGGG + Intergenic
989462468 5:41716357-41716379 AGGTTTTTAAGGGCAAACAAGGG + Intergenic
989619885 5:43373689-43373711 AGATTATAAAAGATGAAGAAAGG - Intergenic
989696343 5:44205391-44205413 AGATTTAAAAAGACAAAGAAGGG - Intergenic
990768450 5:59214720-59214742 AGTTGTTTAGAGATGAAGAAGGG + Intronic
991392735 5:66165786-66165808 GGGATTTTAAAGAAGGAGAAAGG + Intronic
991644775 5:68790867-68790889 ATGTTTTTAAGGACCAAGATGGG - Intergenic
992579645 5:78158577-78158599 ATTATTTTAAAGATGAAGAAAGG + Intronic
992699288 5:79324665-79324687 ATTTTTTAAAAGATGAAGAATGG + Exonic
996237960 5:121156744-121156766 AGGATTTTAAATAGGAAGAGAGG - Intergenic
998086553 5:139330610-139330632 AGGTTTTTAAAAACCACAAATGG - Exonic
998549611 5:143064518-143064540 ATTTTTTTTAAGACTAAGAATGG + Intronic
999011013 5:148040584-148040606 TGGATTTTAAAAATGAAGAAAGG + Intronic
999352521 5:150888204-150888226 AGATTTAGAAAGACAAAGAAGGG + Intronic
999469164 5:151835987-151836009 AGGTATTTAAATAGGAAGAGAGG + Intronic
1000614224 5:163410162-163410184 AGGATTTTAAAGGCAAAAAAAGG - Intergenic
1001225147 5:169937907-169937929 AGGATGTGAAAGACAAAGAAGGG - Intronic
1001940086 5:175734095-175734117 AGGTTTTTATAGGCCCAGAATGG - Intergenic
1003310109 6:4963320-4963342 AGATCTTTAAATAGGAAGAAGGG - Intergenic
1003768250 6:9266011-9266033 AGGTTTTCATAGACTAAGATTGG + Intergenic
1003997458 6:11557068-11557090 AGATTGTTAAAGACCAAGCATGG - Intronic
1005482301 6:26266168-26266190 AGGTTTTTAAAGGCAAAAAAGGG + Intergenic
1005666877 6:28066612-28066634 AGGGTTTCAAAGAACAAGAAAGG + Intergenic
1009577607 6:65487138-65487160 AGGTTTTCAAATAGGAAGAGAGG - Intronic
1009776845 6:68216385-68216407 AGATTTAAAAAGACAAAGAAGGG - Intergenic
1010126942 6:72443352-72443374 AGTTATTTTAAGCCGAAGAAAGG + Intergenic
1010705054 6:79098286-79098308 ATGTTTTTAAAGTTTAAGAATGG - Intergenic
1011001765 6:82597712-82597734 AGGTTTTTAAAAATGGAGTAGGG + Intergenic
1011029490 6:82906427-82906449 AGGTTTTTACTGACAAAGATGGG - Intronic
1011111403 6:83840583-83840605 AGGTTATGTAAGACAAAGAAAGG + Intergenic
1011481178 6:87795625-87795647 ATGTTTGTAGAGAAGAAGAAAGG - Intergenic
1012106805 6:95171529-95171551 AGGTTTTTAAAGTTGATTAAAGG + Intergenic
1012199765 6:96391570-96391592 AAGTTTTTAAAGCGAAAGAAGGG + Intergenic
1012601704 6:101106329-101106351 GAGTTTTAAAAGATGAAGAAAGG + Intergenic
1013038720 6:106412467-106412489 AGATTTTTAAAGAAATAGAAAGG - Intergenic
1013507994 6:110818276-110818298 AGATTTTTAAAGGCAAAAAAAGG + Intronic
1013563890 6:111335989-111336011 AGATTTTTAAAGAACATGAAGGG + Intronic
1013565394 6:111354629-111354651 ATGTTTTTAGAGAGGAAAAATGG - Intronic
1014124619 6:117761972-117761994 AGGTTAAAAAAGACAAAGAAGGG + Intergenic
1015116814 6:129659110-129659132 AGGATTTCAAAGACATAGAATGG - Intronic
1015236866 6:130980724-130980746 AGTTGTTTAAAAAGGAAGAAAGG + Intronic
1015241543 6:131029526-131029548 AATTTTTTAAACACGCAGAAAGG + Intronic
1015318672 6:131846563-131846585 AGTTGTTTAAAGAAGGAGAAAGG - Intronic
1015386333 6:132628405-132628427 AGGTATTCAAATAGGAAGAAAGG - Intergenic
1015488367 6:133797928-133797950 AGATTTAAAAAGACAAAGAAGGG - Intergenic
1015574462 6:134656723-134656745 GCGTTTTTAAAGACAAAGATGGG - Intergenic
1015584916 6:134766140-134766162 AAGTTCTTAAAAACAAAGAATGG - Intergenic
1015795633 6:137008270-137008292 ATGATTTTAAAGAAGAAAAAAGG + Intronic
1016242103 6:141942477-141942499 AGATTTAAAAAGACAAAGAAAGG + Intergenic
1016621239 6:146110926-146110948 AGGGTTTTAAAGAAGAAAGAAGG + Intronic
1017025172 6:150175176-150175198 AGGTTTATTAAGAGGATGAAAGG - Intronic
1017575701 6:155800273-155800295 AGGTTTTTACACAGGAATAAAGG + Intergenic
1018029524 6:159831044-159831066 AGTTTTTTAAAGACTAAAAAAGG + Intergenic
1018437569 6:163776627-163776649 AGTTTTTTAAATGAGAAGAATGG + Intergenic
1019756594 7:2775390-2775412 AGGTTCTGGAAGACGAAGAGTGG + Intronic
1019880996 7:3860901-3860923 AGGTTTTTAAAGGCAAAAAGTGG - Intronic
1020575703 7:9924343-9924365 AGGTTTTCAAATAGGAAGAGAGG + Intergenic
1020808129 7:12816178-12816200 ATTTTTTTAAATACTAAGAATGG - Intergenic
1021049841 7:15969565-15969587 AGGTTATGAAAGAAGGAGAAAGG + Intergenic
1021569202 7:22047276-22047298 ATGGTTTTAAAGAGAAAGAAGGG - Intergenic
1021932019 7:25590397-25590419 AGATATTTAAAGACTAAGAAAGG + Intergenic
1022864780 7:34406265-34406287 AGATTTTTAAGGAAGAAGGAGGG + Intergenic
1023341001 7:39219424-39219446 AGGTTCTTTAAAAAGAAGAAAGG - Intronic
1023619640 7:42056583-42056605 ATTTTTTTAAAGACAGAGAAGGG + Intronic
1023900682 7:44476146-44476168 AGCTGTTTAAAGACGAAACAAGG + Intronic
1023988740 7:45114879-45114901 AGGTTTTTAAAGGTAAAAAAGGG + Intergenic
1024889400 7:54183390-54183412 AGGATTTTAATGACTAAGATGGG + Intergenic
1026467438 7:70666586-70666608 AGGTTTTGAGACAGGAAGAAGGG - Intronic
1027181355 7:75941886-75941908 AGGTTTGTTAATAAGAAGAATGG + Intronic
1027641016 7:80734021-80734043 AGGCTTTTTGAGAGGAAGAATGG - Intergenic
1027665423 7:81038550-81038572 AGATTTTAAAAGTAGAAGAAAGG + Intergenic
1027863831 7:83621022-83621044 AGGTTTTTAAATAAGAAGAGAGG + Intronic
1028283360 7:88962144-88962166 AGGTTTTTATAGACCTAAAATGG + Intronic
1028606157 7:92658105-92658127 AGATTCTCAAAGATGAAGAAAGG - Intronic
1028652480 7:93166422-93166444 AGGTTTCTAAAGGTGAAGAGGGG + Intergenic
1028991501 7:97053272-97053294 AGGTCATAAAAGACAAAGAAGGG + Intergenic
1030428621 7:109413099-109413121 AAGTTTTTTAAGATGAAAAATGG + Intergenic
1030771527 7:113481472-113481494 ATGTTATAAAAGACGAAGACTGG - Intergenic
1031955757 7:127940651-127940673 AGCTTTTCAATGATGAAGAATGG - Intronic
1032109665 7:129065075-129065097 AGGTTTTTAAAGTCAAAAAAGGG - Intergenic
1035471858 7:159115465-159115487 AAGTTTTGAAAGAGGAAGATTGG - Intronic
1035485358 7:159219499-159219521 AGATTTTTAAAGACAAAAAGGGG + Intergenic
1036744546 8:11395847-11395869 AAGTTGTTAAAGACGTTGAAAGG + Intronic
1037212357 8:16406343-16406365 AGTTTTTAAAAGAAAAAGAAAGG - Intronic
1037709765 8:21346408-21346430 GGGTTTTTAAAAAAGAAAAAAGG + Intergenic
1038466993 8:27773395-27773417 AGGTTTTTAAAGACGAAGAAGGG - Intronic
1038525472 8:28269360-28269382 AGGTCTTGGAAGAGGAAGAAGGG + Intergenic
1039841610 8:41297434-41297456 AAGTTTTTTAGGAAGAAGAATGG - Intronic
1040434837 8:47380273-47380295 AGGTTTTAAAACACACAGAATGG + Intronic
1040732652 8:50468822-50468844 AGATTTTTAAAAACGCATAATGG - Intronic
1041806179 8:61851707-61851729 AGATTTTTAAAGGCAAAAAATGG - Intergenic
1043032711 8:75157471-75157493 AGGTTTTTAAAGATAAAAGATGG - Intergenic
1044153951 8:88819254-88819276 AGCTTTTTAAAGATGTAGAATGG - Intergenic
1044633276 8:94299364-94299386 AGGACTTGAAAGACGCAGAATGG - Intergenic
1045301152 8:100911335-100911357 TGGTTTTTACAAAGGAAGAAAGG + Intergenic
1045966090 8:108026232-108026254 AGGTCATAAAAGACAAAGAATGG + Intronic
1046047579 8:108982578-108982600 AGGTATTCAAATAGGAAGAAAGG - Intergenic
1046349068 8:112982331-112982353 AGGTTTTAAAAGAAGAATCATGG + Intronic
1047466689 8:125123017-125123039 ATGTCTTTAAAGGCTAAGAATGG + Intronic
1047947786 8:129899711-129899733 AGGTTTTTAAAGGAGAAACAAGG + Intronic
1048141590 8:131800128-131800150 GGGTTTTTAATGAAGAAGAATGG - Intergenic
1048451962 8:134541315-134541337 AGCTTTATTAAGACGAGGAAGGG + Intronic
1049176553 8:141196258-141196280 AGGTTTCTAAAGCCGAGGCAGGG - Intergenic
1049531171 8:143156377-143156399 AGGTATTTAAAGACACAAAAAGG - Intergenic
1051802035 9:20945897-20945919 AGGTTTTTTATCACGAAAAAAGG + Intronic
1052386896 9:27833388-27833410 AGGTATTCAAATAGGAAGAAAGG - Intergenic
1052396939 9:27949857-27949879 AGGTGTTTAAAGGCAAGGAAGGG + Exonic
1052621236 9:30912698-30912720 GGGTTTTTGAAGATGAAGAAAGG + Intergenic
1053537997 9:38945449-38945471 AGGTTTATAAAGACAAAAAATGG - Intergenic
1053742944 9:41159719-41159741 AGGTTTTTACAGATGGAGTAGGG - Intronic
1054348221 9:63989543-63989565 AGGTTTTTACAGATGGAGTAGGG - Intergenic
1054445947 9:65315902-65315924 AGGTTTTTACAGATGGAGTAGGG - Intergenic
1054484323 9:65705608-65705630 AGGTTTTTACAGATGGAGTAGGG + Intronic
1054569430 9:66793761-66793783 AGATTTTTAAAGGCAAAAAAGGG - Intergenic
1054628137 9:67418472-67418494 AGGTTTATAAAGACAAAAAATGG + Intergenic
1054685399 9:68271581-68271603 AGGTTTTTACAGATGGAGTAGGG + Intronic
1054740651 9:68802885-68802907 AGGATTTTAAAGAAGGAGAGTGG + Intronic
1054874220 9:70078483-70078505 AAGTTTTTAAAGGTGAAGAAAGG + Intronic
1055666327 9:78556615-78556637 AGGTTTTTAAAGTGGCAGAGTGG - Intergenic
1055972638 9:81927072-81927094 GGGTTTTTAAAGTGGAAAAAGGG - Intergenic
1055974391 9:81942144-81942166 GGGTTTTTAAAGTGGAAAAAGGG - Intergenic
1057867935 9:98696192-98696214 AGGATTTAAAAGATGAAGAAAGG + Intronic
1058154478 9:101499504-101499526 AGGTTTTTAAAGAAAAAAAAAGG + Intronic
1058360615 9:104142419-104142441 AGGTTTATTTAGACGTAGAAAGG + Intergenic
1058759048 9:108112177-108112199 AGTTTTTTAAAGAAGATCAAAGG - Intergenic
1059057114 9:110995485-110995507 GGGTTTTCAATGAGGAAGAATGG - Intronic
1059493382 9:114688714-114688736 AGTTTTTTAAAAAAGAAGAAAGG - Intergenic
1059654204 9:116342481-116342503 ACTTTTTTAAAGACCCAGAAAGG - Intronic
1059756158 9:117295564-117295586 AGCATTTTAAAGATGAAAAAGGG - Intronic
1062742953 9:138191246-138191268 AGGTATTTAAATAGGAAGAGAGG - Intergenic
1062743202 9:138193246-138193268 AGGTATTTAAATAGGAAGAGAGG - Intergenic
1062743451 9:138195247-138195269 AGGTATTTAAATAGGAAGAGAGG - Intergenic
1203525124 Un_GL000213v1:81903-81925 ATTTTTTAAAAGACGCAGAAGGG - Intergenic
1187267920 X:17753547-17753569 TGGTTTTTAAAGAAGTAGACTGG - Exonic
1187797089 X:23015537-23015559 AGGTTTTTTAAAACAAAAAATGG + Intergenic
1188294829 X:28434654-28434676 ACCTTTTTAAAGAAGCAGAATGG + Intergenic
1188528969 X:31116671-31116693 AGGTCTTTGAAGACAGAGAAAGG + Intronic
1189033561 X:37473620-37473642 AGATTTTTAAAGGCAAAAAAGGG - Intronic
1189640603 X:43066907-43066929 AGGGTTTGAAAGAGAAAGAAAGG + Intergenic
1189749025 X:44199906-44199928 AGGTCATAAAAGACAAAGAAAGG + Intronic
1190111994 X:47596356-47596378 AGCTTTTTAAAGCCTAATAATGG - Intronic
1190600402 X:52086959-52086981 AGATTTTAAAAGACAAAGAAGGG - Intergenic
1190817765 X:53943853-53943875 AGGTTTTTACACACCAAAAAAGG + Intronic
1191029674 X:55955153-55955175 AGGCTGTTAAAGAGGAAAAAAGG + Intergenic
1191037486 X:56042594-56042616 AGATTTAAAAAGACAAAGAAGGG - Intergenic
1191084957 X:56556094-56556116 AGGTTATTAGAGGCTAAGAAGGG + Intergenic
1191648853 X:63513960-63513982 AGGTTTTTGAAGGCAAAAAATGG - Intergenic
1193171302 X:78339541-78339563 ATGTTTTAAAAAACAAAGAAGGG - Intergenic
1193460320 X:81783804-81783826 TGGATTTTAAAGACTCAGAAGGG - Intergenic
1194238124 X:91409921-91409943 AAATTTTAAAAGACAAAGAAGGG + Intergenic
1194261113 X:91697376-91697398 TGATTTTAAAAGACAAAGAAGGG - Intergenic
1194284799 X:91996447-91996469 TGATTTTTAAAAATGAAGAAGGG - Intronic
1194613098 X:96067641-96067663 AGTTTTTTAAAGACTGAGAAGGG - Intergenic
1194625163 X:96218698-96218720 AGGTATTTAAATAGGAAGATAGG + Intergenic
1195726344 X:107921171-107921193 ATGTTGTTCAAGACAAAGAAAGG - Intronic
1195882535 X:109607569-109607591 AGGTATTCAAATAGGAAGAAAGG + Intergenic
1196396372 X:115266622-115266644 ATGTTTCTAAAGATGTAGAATGG - Intergenic
1197029723 X:121799102-121799124 TGGTTTTTAAATAGGAAGAGAGG - Intergenic
1198279457 X:135127318-135127340 ATGTTAATAAAGATGAAGAAGGG + Intergenic
1198291499 X:135245196-135245218 ATGTTAATAAAGATGAAGAAGGG - Intergenic
1198407064 X:136323920-136323942 AGGTCATGAAAGACAAAGAAAGG - Intronic
1198622069 X:138523870-138523892 AGATTTTTAATGAAGTAGAATGG - Intergenic
1200368212 X:155690577-155690599 AGTTTTGAAAAGACAAAGAAGGG + Intergenic
1200579762 Y:4936177-4936199 TGATTTTAAAAGACAAAGAAGGG - Intergenic
1200602366 Y:5221017-5221039 TGATTTTTAAAAATGAAGAAGGG - Intronic
1200860857 Y:7990724-7990746 AGATTTAAAAAGACAAAGAAGGG + Intergenic
1200885211 Y:8260759-8260781 AGGATTCTAAAGAGGAAAAAAGG - Intergenic
1201458212 Y:14194179-14194201 AGGTCTTTACAGGCAAAGAATGG - Intergenic