ID: 1038468068

View in Genome Browser
Species Human (GRCh38)
Location 8:27784861-27784883
Sequence CACTGAGGCAATTTAAGGTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1038468068_1038468074 12 Left 1038468068 8:27784861-27784883 CCTCACCTTAAATTGCCTCAGTG No data
Right 1038468074 8:27784896-27784918 GCACAGCTTTCCCTCTTCAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1038468068 Original CRISPR CACTGAGGCAATTTAAGGTG AGG (reversed) Intronic