ID: 1038468421

View in Genome Browser
Species Human (GRCh38)
Location 8:27788671-27788693
Sequence ATTTTGTCTTGGGGGAGGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 572
Summary {0: 1, 1: 0, 2: 3, 3: 48, 4: 520}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1038468412_1038468421 4 Left 1038468412 8:27788644-27788666 CCACTGTGCCTGGCCTGATCTCA 0: 1
1: 15
2: 184
3: 1367
4: 6303
Right 1038468421 8:27788671-27788693 ATTTTGTCTTGGGGGAGGGAAGG 0: 1
1: 0
2: 3
3: 48
4: 520
1038468413_1038468421 -4 Left 1038468413 8:27788652-27788674 CCTGGCCTGATCTCATTTCATTT 0: 1
1: 1
2: 5
3: 96
4: 677
Right 1038468421 8:27788671-27788693 ATTTTGTCTTGGGGGAGGGAAGG 0: 1
1: 0
2: 3
3: 48
4: 520
1038468410_1038468421 23 Left 1038468410 8:27788625-27788647 CCGAGATTACAGGCGTGAGCCAC 0: 87
1: 1816
2: 4569
3: 4598
4: 4145
Right 1038468421 8:27788671-27788693 ATTTTGTCTTGGGGGAGGGAAGG 0: 1
1: 0
2: 3
3: 48
4: 520
1038468414_1038468421 -9 Left 1038468414 8:27788657-27788679 CCTGATCTCATTTCATTTTGTCT 0: 1
1: 0
2: 7
3: 55
4: 544
Right 1038468421 8:27788671-27788693 ATTTTGTCTTGGGGGAGGGAAGG 0: 1
1: 0
2: 3
3: 48
4: 520

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1038468421 Original CRISPR ATTTTGTCTTGGGGGAGGGA AGG Intronic
900233194 1:1572868-1572890 ATTTTGTCTTGGGGGGGGGGGGG + Intronic
901106123 1:6758054-6758076 ATTGTGTCTTTGGGGAGGCTTGG + Intergenic
902074765 1:13775515-13775537 AATTAGTCTAGGGGGAGAGAAGG + Intronic
902177626 1:14662724-14662746 AGTGTGTGTTGGGGAAGGGAGGG + Intronic
902728753 1:18354626-18354648 AATTAGGCTTGGGGGAGGGATGG - Intronic
902860809 1:19244115-19244137 ATTTTATCTCGAGGGAGTGAAGG + Intronic
903808891 1:26023436-26023458 CTTTTGCCTTGGGGGCTGGATGG + Intronic
903944428 1:26952601-26952623 ACTTTCTCTTTGTGGAGGGAGGG - Intronic
904947367 1:34209423-34209445 ATTGAGTCTTGGGGCAGGGATGG + Intronic
906301901 1:44688780-44688802 ATTTTCAGTGGGGGGAGGGAAGG - Intronic
906484329 1:46222557-46222579 ATTCTGTGTTGGGGAAGGGAAGG + Intergenic
907788945 1:57642527-57642549 ATTGGGGCTTGAGGGAGGGAGGG - Intronic
908061348 1:60353075-60353097 AAATTGGCTTGAGGGAGGGAGGG - Intergenic
908979395 1:69935881-69935903 GTTTTGGCTTTGAGGAGGGAAGG - Intronic
909363875 1:74797355-74797377 ATTCTGTCTTATTGGAGGGAGGG - Intergenic
909505007 1:76378656-76378678 TTTTTTTTTTGGGGGGGGGAAGG - Intronic
909702186 1:78538242-78538264 ATTTTGACTGGGGAGAGGCATGG + Exonic
910793628 1:91075958-91075980 GTTGTGGCTTTGGGGAGGGAAGG + Intergenic
911592191 1:99761121-99761143 ATTTTGTTTTGGGGGGGTGGGGG + Intronic
911812655 1:102303187-102303209 AGTTTGTCTTGAGGGAGGGTGGG + Intergenic
911842235 1:102697798-102697820 TTTTCCTCTTGGGAGAGGGAGGG - Intergenic
911881449 1:103244141-103244163 ATTTTTTTTTGAGGGAGGCAGGG + Intergenic
912622204 1:111173153-111173175 ATTCTGTCTTGGGTGGAGGAGGG - Intronic
912845978 1:113074898-113074920 ACTCCGTCTGGGGGGAGGGAGGG + Intronic
913389648 1:118296205-118296227 ACTGTGTGTTGTGGGAGGGAAGG - Intergenic
914024307 1:143898565-143898587 CTTTTTTTTTGGGGGGGGGACGG - Intergenic
915349787 1:155217119-155217141 GTTTTGTCCTGGGGGTGGGAGGG - Intergenic
915353044 1:155238396-155238418 GTTTTGTCCTGGGGGTGGGAGGG - Intronic
915464711 1:156090039-156090061 ATGCTGTCTTGGGGCAGGGAGGG + Intronic
915692593 1:157704468-157704490 GTTTTTTTTGGGGGGAGGGAGGG + Intergenic
916984986 1:170181535-170181557 ATTTTGTTTTGGAGAGGGGATGG - Intergenic
917102988 1:171464056-171464078 ATTTTTTATTGGCAGAGGGATGG - Intergenic
917173991 1:172210959-172210981 TTTTTGTTTTGAGGGAGGGAAGG - Intronic
917685800 1:177414568-177414590 ATTTTGCCTTAGGGGATGAATGG - Intergenic
918131859 1:181636701-181636723 AACTTGTTTTGGAGGAGGGAGGG + Intronic
920543713 1:206798447-206798469 AAATTGACTTGGGGGTGGGAAGG - Intergenic
920697198 1:208189993-208190015 ATTTTGGGGTGGGGGAAGGAGGG + Intronic
920970169 1:210736537-210736559 ATTTTTTTTTGGAGGGGGGATGG - Intronic
921602457 1:217121052-217121074 ACTTTGCCTGGGGGAAGGGAGGG + Intronic
923108475 1:230872040-230872062 TTTTTGTTTTGGGGGGGGGGGGG + Intergenic
923348110 1:233077215-233077237 ATTTTATTTTGGTGGGGGGAAGG + Intronic
923552088 1:234972204-234972226 TGTGTGTATTGGGGGAGGGATGG + Intergenic
923563360 1:235058555-235058577 ATTTTTTTTTTGGGGGGGGATGG + Intergenic
924335707 1:242985199-242985221 AATCTGTCTTGGGTTAGGGATGG - Intergenic
924374291 1:243389147-243389169 TTTTTTTTTTGGGGGGGGGAGGG - Intronic
924379353 1:243447406-243447428 CTTTTATTTTGGGGGAGGAAGGG + Intronic
924454279 1:244206042-244206064 ATTTAGCCTTGGCGGGGGGAGGG + Intergenic
924501668 1:244644024-244644046 ATTTTGTTAGGGGGAAGGGAAGG - Intergenic
924929984 1:248721925-248721947 ATTTGCTCTTAGGGGAGGCAGGG + Intronic
1062822559 10:545747-545769 TTTTTGTGTAGGGTGAGGGAGGG + Intronic
1063532504 10:6848162-6848184 TTTTTGTCGGGGGGGTGGGACGG + Intergenic
1063635428 10:7777892-7777914 TTTTTTTTTTGGGGGGGGGACGG - Intronic
1064212342 10:13370730-13370752 ATTCTGACTTTTGGGAGGGAGGG + Intergenic
1064241364 10:13632339-13632361 ATTTTTTTTTGCGGGGGGGAGGG - Intronic
1064316923 10:14266148-14266170 TCTTTGTCCTGGGGGTGGGAGGG + Intronic
1064434634 10:15300594-15300616 ATTTTTTTTGGGGGGTGGGAGGG - Intronic
1064888929 10:20146534-20146556 ATATTGTCCTGAGGGAGGGAGGG - Intronic
1065046229 10:21749483-21749505 ACCCTGTCTTGGGGGAGGGGCGG - Intergenic
1068213289 10:53951314-53951336 ATTTTTTGGTGGGGGTGGGAGGG - Intronic
1068532021 10:58200121-58200143 TTTTTTGGTTGGGGGAGGGACGG + Intronic
1068635694 10:59345725-59345747 ATTTTATCTTGGAAGAGTGAAGG + Intronic
1068928096 10:62560603-62560625 ATATTCTCTTGGGGAGGGGATGG - Intronic
1068992324 10:63163039-63163061 ATTTTGCCTGGGGTTAGGGAAGG - Intergenic
1069372422 10:67762371-67762393 TTTTTTTTTTGGGGGGGGGAGGG - Intergenic
1069582356 10:69574493-69574515 ATTTTGTATGGGGTGAGGGGCGG + Intergenic
1069732775 10:70629855-70629877 ACTTTTTTTTGGGGGGGGGAGGG + Intergenic
1070066658 10:73041536-73041558 TTTTTTTTTTGGGGGGGGGATGG - Intronic
1070306632 10:75243500-75243522 ATCTTCTTTTGGGGGAAGGAGGG - Intergenic
1070620671 10:78008001-78008023 CTTTTTTTTGGGGGGAGGGAGGG + Intronic
1071858664 10:89650590-89650612 ATTTTGGCTGGGGGGAGTGGGGG - Intergenic
1073544386 10:104336485-104336507 ATTTTTTTTTGGGGGGGGGGGGG + Intronic
1073571160 10:104582181-104582203 TTTTTTTCTTGAGGGAAGGAAGG - Intergenic
1074089369 10:110233342-110233364 AGTTTTTCTGGGGAGAGGGATGG + Intronic
1074311305 10:112325458-112325480 ATTTTTTTTTGGCGGGGGGATGG - Intergenic
1074406558 10:113184645-113184667 ATTTGGCCCTGGGGGAGGGATGG - Intergenic
1074553322 10:114465571-114465593 ATTTTGCTCTGGGAGAGGGATGG + Intronic
1074911678 10:117915765-117915787 ATTTTAACTGGGGGGGGGGAGGG - Intergenic
1075303733 10:121348901-121348923 ATCTTTTCTTGGGGGAGTGAAGG + Intergenic
1076896821 10:133317223-133317245 TCTGTGTCCTGGGGGAGGGAGGG - Intronic
1077039747 11:514605-514627 TTTTGGTCTTGAGGGAGGGTAGG + Intergenic
1078601299 11:12733425-12733447 AATTTTTCTTGAGGAAGGGAAGG + Intronic
1078809849 11:14747688-14747710 TGTGTGTATTGGGGGAGGGAAGG + Intronic
1079333071 11:19549419-19549441 GCTTTCTCTTGGGGGATGGAAGG + Intronic
1080090564 11:28343182-28343204 ATTTTTTCATGGGGTGGGGAAGG + Intergenic
1081844725 11:46231795-46231817 ATTTTTTTTTGGGAGGGGGATGG - Intergenic
1081867489 11:46367560-46367582 GGTTTGTCTTGGGAGAGGGCGGG + Intronic
1081957489 11:47106249-47106271 ACTTTGTCTTAGGGGTGGGAAGG + Intronic
1082833920 11:57638722-57638744 ATTCTCTCTTGGGGAAGGGAGGG + Intergenic
1083468093 11:62862519-62862541 GTTTAGGCTTGGGGGAGGGGTGG - Intronic
1083951149 11:65957055-65957077 AGGTTGTCCTGTGGGAGGGAGGG + Intronic
1085107296 11:73856329-73856351 ATTTTTCCTTGGGGGAGGGTGGG + Intronic
1085287395 11:75372589-75372611 ATTTTTTGTTGGGGGAGGAAAGG + Intergenic
1085431618 11:76455552-76455574 ATTTTGAGTGGGGGGAGGGGAGG - Intronic
1085761695 11:79247001-79247023 GTTTTGTTTTGGGGGTGGGGGGG - Intronic
1085771418 11:79329431-79329453 CTTTTGTTTTGGTGGAGAGATGG + Intronic
1086924610 11:92626647-92626669 ATTTTGTCTTGATGGAGAAATGG + Intronic
1087083982 11:94198138-94198160 AATTTGTCCTGAGGTAGGGAGGG + Intergenic
1087199935 11:95335248-95335270 ATTTGGCCTTGGGGAGGGGAGGG + Intergenic
1087821524 11:102718100-102718122 ATTTTTTTTGGGGGGGGGGATGG - Intronic
1087938103 11:104059465-104059487 ATGTTCACTTGGGGGAGAGAGGG - Intronic
1088988861 11:114933676-114933698 ATCTTGTCTTGAGGGGGTGATGG - Intergenic
1089011084 11:115132384-115132406 ATTTTGGCTTGGGGGATGGAGGG + Intergenic
1089170485 11:116508133-116508155 CTTTTGTTCTGGTGGAGGGAAGG + Intergenic
1089239979 11:117069175-117069197 ATTTTTTTTTGGGGGGGGGGGGG + Intronic
1089504822 11:118956251-118956273 ATTTTGTCCTGGGGGTGGGAGGG - Intronic
1089916161 11:122159056-122159078 TCTTTGTGTTGGGGGAGGGGTGG + Intergenic
1090022204 11:123137994-123138016 TTTATGGTTTGGGGGAGGGAGGG - Intronic
1092468130 12:8753099-8753121 ATTTTGTGTTTCGGCAGGGATGG + Intronic
1094702723 12:32885657-32885679 TTTTTTTTTTGGGGGGGGGACGG - Intronic
1095927502 12:47593502-47593524 AATTTTTGTTGGGGGAGGGTAGG - Intergenic
1096837827 12:54362341-54362363 ATTTCGTCATGCAGGAGGGATGG + Intergenic
1097117356 12:56707370-56707392 TTTTTTTTTTGGGGGGGGGATGG + Intergenic
1097397591 12:59094580-59094602 ATTTAGTCTTGGCGGTGGGATGG + Intergenic
1097637872 12:62144447-62144469 TTTTTTTTTTGGTGGAGGGAGGG - Intronic
1098433637 12:70447072-70447094 ATTTTTGCCTGGGGGAAGGATGG + Intergenic
1098499693 12:71177160-71177182 ATTTTACCTTGGGTGAGGGGTGG + Intronic
1098865441 12:75757670-75757692 ATCATGTTTTGGGTGAGGGAGGG + Intergenic
1099082191 12:78198715-78198737 GTTTTGTGTTGGGGGGGGCAGGG + Intronic
1100441114 12:94617763-94617785 ACTCTGTGTTGGGGGTGGGATGG + Intronic
1101269634 12:103130008-103130030 ATTTTTCCATGGGAGAGGGATGG - Intergenic
1101826690 12:108225864-108225886 TTTTTGTGGTGGAGGAGGGATGG - Intronic
1102241180 12:111325721-111325743 GTGTTGTGTTGGGGGAGGGGTGG + Intronic
1102241209 12:111325823-111325845 GTGTTGTGTTGGGGGAGGGGTGG + Intronic
1102241218 12:111325858-111325880 GTGTTGTGTTGGGGGAGGGGTGG + Intronic
1102241227 12:111325890-111325912 ATAGTGTGTTGGGGGAGGGGTGG + Intronic
1102241236 12:111325922-111325944 ATAGTGTGTTGGGGGAGGGGTGG + Intronic
1102241375 12:111326406-111326428 GTGTTGTGTTGGGGGAGGGGTGG + Intronic
1102292675 12:111713926-111713948 TTTTTTTTTTGGGGGGGGGACGG - Intronic
1102653789 12:114462963-114462985 AGTATGTCTTGGGGGAGAGAAGG + Intergenic
1102781211 12:115566471-115566493 ATTGTGTGTTGGGGGTGGGTGGG - Intergenic
1103131762 12:118475280-118475302 ATTTTATCCTGGGCTAGGGATGG + Intergenic
1103224979 12:119279117-119279139 ATTTTTTTTGGGGGGGGGGATGG - Intergenic
1103298290 12:119906905-119906927 CCTGTGTATTGGGGGAGGGAAGG - Intergenic
1104625942 12:130354749-130354771 AGGTTTTCTGGGGGGAGGGAAGG - Intronic
1104825730 12:131708054-131708076 TTTTTGTCTTTGGGGTAGGAAGG + Intergenic
1105786003 13:23749955-23749977 ATTGCCACTTGGGGGAGGGAGGG - Intronic
1106434231 13:29709533-29709555 ATTTTGACTTAGGGAGGGGAAGG - Intergenic
1106630747 13:31469802-31469824 CATTTGTCTTGGGTGATGGATGG - Intergenic
1106808359 13:33334556-33334578 TTTATGTCTTGGGGGTGAGAGGG - Intronic
1106840983 13:33684851-33684873 ATTGTTTCTTGGGGGCAGGAGGG - Intergenic
1107714545 13:43187181-43187203 ATCTTATCTTGGAAGAGGGAGGG + Intergenic
1108500782 13:51067948-51067970 ATTATGTCATGGAGGAGAGAAGG - Intergenic
1108922415 13:55692711-55692733 ATTTTTTCCAGGGGTAGGGAAGG - Intergenic
1109881465 13:68483589-68483611 ATTTTCTCTTGGAATAGGGAAGG + Intergenic
1110229881 13:73156927-73156949 ATTTTGTTTGGGGCAAGGGATGG + Intergenic
1110460491 13:75739648-75739670 ATTTTGCCGTGGGAGAGTGAGGG - Intronic
1111078305 13:83267960-83267982 AATATGTCTTGGAGAAGGGAGGG - Intergenic
1111629971 13:90838051-90838073 TTTTTATCTTGGGGGTGGGGAGG - Intergenic
1111748931 13:92303142-92303164 AATAGGTCTTGGGAGAGGGATGG + Intronic
1113297565 13:108976994-108977016 TTGTTGTCTCTGGGGAGGGAAGG - Intronic
1113708113 13:112447029-112447051 AGTGTGTCTGCGGGGAGGGAAGG - Intergenic
1115988090 14:39123361-39123383 ATTTTTTCTTGGGCAGGGGAGGG - Intronic
1116182365 14:41551234-41551256 TCTGTGTCTTGGGGGAGGGTTGG - Intergenic
1116331814 14:43606020-43606042 ATTTTTTGGTGGGAGAGGGAAGG + Intergenic
1117463785 14:55972407-55972429 ATTTTCCCTGGGGGGAGGGGAGG + Intergenic
1117479483 14:56128878-56128900 ATTTGTTTTTGGGGGAGGGCAGG + Intronic
1117533190 14:56678547-56678569 ATTTTGTATATGGGGAGAGATGG - Intronic
1117994938 14:61469573-61469595 ATTTTGTCTTCAGGGTGGGGTGG - Intronic
1118360584 14:65053356-65053378 GTTTTCTCTCTGGGGAGGGAAGG + Intronic
1119084479 14:71727495-71727517 AGTTTCTCTTATGGGAGGGATGG + Intronic
1119357873 14:74021900-74021922 TTTTTTTTCTGGGGGAGGGACGG - Intronic
1119503576 14:75152270-75152292 TTTTTGTCTTTGGGGATGGTTGG - Intronic
1119587620 14:75851443-75851465 ATTTAGCCTTGGGGGAGGGGAGG + Intronic
1119978122 14:79048637-79048659 ATTTTTTGCTGGTGGAGGGAGGG + Intronic
1120037389 14:79713504-79713526 ATTTTGCCTTGGGTTAGAGAGGG + Intronic
1120037398 14:79713679-79713701 ATTTTGCCTTGGGTTAGAGAGGG - Intronic
1120765880 14:88326178-88326200 ATTTTTTTTTGGGGGGGGGCGGG - Intronic
1120933413 14:89871250-89871272 AGTTTGTTTTGGGAGATGGATGG - Intronic
1121774807 14:96583659-96583681 AGTGTGTGTTGGGGGAGGGCGGG + Intergenic
1121941317 14:98073642-98073664 ATTATGTTTTAGGGGAAGGAGGG - Intergenic
1121959704 14:98247968-98247990 ACTTTTTCTTGGTGGGGGGAGGG + Intergenic
1123067551 14:105626233-105626255 ACTTTGGCTGGGGGCAGGGAGGG - Intergenic
1123144845 14:106118889-106118911 ACTCTGACTTGGGGAAGGGAAGG + Intergenic
1124397091 15:29311683-29311705 ACTTTTTTTTGGGGGGGGGATGG - Intronic
1125183552 15:36905255-36905277 ATTTTGTCGGGGGGTGGGGAGGG + Intronic
1125461336 15:39909592-39909614 TCTTTGTTTTGGGAGAGGGAAGG - Intronic
1125467183 15:39965622-39965644 GTTTTCTCTTGGGGGAAGGAAGG - Intronic
1126282400 15:46970018-46970040 TGTGTGTGTTGGGGGAGGGAGGG - Intergenic
1126383863 15:48074302-48074324 ACTTTGGCTTGGGGCTGGGATGG - Intergenic
1126436939 15:48645984-48646006 TTTTTGTCTTGAGGTGGGGAGGG + Intergenic
1127390032 15:58497898-58497920 ATTGTGTGTTGGGGGAGAGGAGG - Intronic
1127641721 15:60922159-60922181 GTTGGGGCTTGGGGGAGGGAAGG + Intronic
1128559258 15:68653845-68653867 TTTTTTTCCTGGGGGAGAGAAGG - Intronic
1128775764 15:70318935-70318957 ATTTTATCTTGTGGGAAGCAGGG - Intergenic
1129046981 15:72744410-72744432 ATTTTTTCTGGGGGAGGGGAGGG + Intergenic
1129915259 15:79264576-79264598 ATTCTTTCATGGGTGAGGGAAGG - Intergenic
1129995379 15:80000226-80000248 ATATTGTATAGGGGGAGGAAAGG + Intergenic
1130570262 15:85036482-85036504 GTTTTGTTTGGTGGGAGGGAAGG - Intronic
1130663588 15:85850856-85850878 TTCTTGTCTTGGGGGAATGAGGG - Intergenic
1131356142 15:91748971-91748993 TTTTAGTCCTGGGGGAGGGGTGG + Intergenic
1131493101 15:92880067-92880089 AGTGTGACTTGGGGGTGGGAGGG + Intergenic
1132852802 16:2032540-2032562 AGTTTGTCTTTGGTGAAGGATGG + Intronic
1133141943 16:3751686-3751708 ATTTTCTCTGGGGTGAGGGAGGG - Intronic
1133394347 16:5434018-5434040 ATTTTGAGTTGGGGTAGGGGCGG + Intergenic
1133528566 16:6630962-6630984 ATTTAGATTTGGGGGAGGGAAGG + Intronic
1133569885 16:7030856-7030878 CTTTTGTCTTAGGGGAGATAAGG + Intronic
1133847531 16:9469257-9469279 ATTTTGATTTGGGGGAAGGACGG - Intergenic
1134744924 16:16580629-16580651 TAGTTGTGTTGGGGGAGGGATGG - Intergenic
1134810272 16:17161281-17161303 ATGACATCTTGGGGGAGGGAGGG + Intronic
1135000560 16:18773140-18773162 TAGTTGTGTTGGGGGAGGGATGG + Intergenic
1136716896 16:32288761-32288783 ATTTTGTCTTGTGTGAGGACGGG + Intergenic
1136835272 16:33495006-33495028 ATTTTGTCTTGTGTGAGGACGGG + Intergenic
1136866307 16:33758367-33758389 TTTTTCTCCTGGGGGCGGGAGGG + Intergenic
1137902119 16:52280041-52280063 GCTTTGTCATGGGGGAAGGAGGG - Intergenic
1137979055 16:53054757-53054779 ACTTTCTCTTGGGGCACGGAGGG - Intergenic
1138244796 16:55459624-55459646 TTTTTTTGTAGGGGGAGGGAGGG - Intronic
1138930887 16:61654604-61654626 AACTTGTCTTGTGGGAGGGCTGG + Intronic
1139116531 16:63961188-63961210 ATTTTGGCTTGGGTGGGGAATGG - Intergenic
1140058846 16:71549690-71549712 ATTCTGTCCAGGGGGAGAGAAGG + Intronic
1140308183 16:73823374-73823396 ATGCTGTCTTGAGGGATGGATGG - Intergenic
1140309620 16:73836414-73836436 TTTTTGTAGTGGTGGAGGGAAGG + Intergenic
1140519684 16:75570395-75570417 AAATTGTCTTGGGGAAGAGATGG - Intronic
1140567671 16:76063435-76063457 ATTTTTTCTTGGTGGTGGGCTGG + Intergenic
1140847758 16:78906416-78906438 ATTTTAGCTTGGGGGAGGGTTGG - Intronic
1141227238 16:82129542-82129564 ATTTTCTCTTGGTGTTGGGATGG - Intergenic
1203009531 16_KI270728v1_random:229026-229048 ATTTTGTCTTGTGTGAGGACGGG - Intergenic
1203105854 16_KI270728v1_random:1357828-1357850 TTTTTCTCCTGGGGGCGGGAGGG - Intergenic
1203127660 16_KI270728v1_random:1604540-1604562 TTTTTCTCCTGGGGGCGGGAGGG + Intergenic
1203145444 16_KI270728v1_random:1795327-1795349 ATTTTGTCTTGTGTGAGGACGGG + Intergenic
1142611807 17:1112587-1112609 ACTCTGTCTTGAGGGAGGGAGGG + Intronic
1142786927 17:2231694-2231716 TTTTTGGGTGGGGGGAGGGAGGG - Intronic
1142877635 17:2861642-2861664 ATTTTTTTTGGGGGGGGGGACGG + Intronic
1143009872 17:3860168-3860190 AAGTGGTCTTGGCGGAGGGAGGG - Intergenic
1144408489 17:14975764-14975786 ATTTGGTATTGGGAGATGGATGG - Intergenic
1145124942 17:20292334-20292356 CTTTTTTTTTGGGGGGGGGACGG + Intronic
1145230545 17:21170381-21170403 ACTTCCTCTTGGGGCAGGGATGG + Intronic
1145300163 17:21628917-21628939 ATTTTTTTTTGTGGGGGGGACGG + Intergenic
1146516482 17:33493721-33493743 ATGCTATCTTGGGGGAAGGATGG - Intronic
1146954318 17:36928297-36928319 ATTTCCCCTTGGGGGAGGGTAGG - Intergenic
1147619497 17:41855980-41856002 GTTTTTTTTTGGGGGGGGGATGG - Intronic
1147730379 17:42596706-42596728 ATTTTGTGTTGAGGGCTGGAAGG + Intronic
1148010065 17:44471775-44471797 CTTTTGTTTGGTGGGAGGGAGGG + Intronic
1150451731 17:65274563-65274585 ATTTTGTCTTTGAAAAGGGAAGG - Intergenic
1150562804 17:66309366-66309388 GTTGTATCTTGGGGAAGGGAAGG + Intronic
1151831479 17:76554718-76554740 CTTTTGTTTTCGGGGAGGAAGGG - Intergenic
1152363264 17:79842069-79842091 ATTTTGTCTTTGTGGATGGTGGG + Intergenic
1154995897 18:21639952-21639974 GTTGTGCCTTGGGGGAAGGAGGG + Intergenic
1155300884 18:24427457-24427479 ATTTTGTGTTGGGGGGAGGTGGG - Intronic
1155401395 18:25443379-25443401 ATTTTGTCTCAGGCCAGGGATGG + Intergenic
1155985438 18:32225998-32226020 ATTTTGTTGGGGGAGAGGGAAGG + Intronic
1156056385 18:33009608-33009630 AATGTGTGTTGGGGAAGGGATGG - Intronic
1156815318 18:41303624-41303646 TATTTGTCTTGGAGGTGGGATGG - Intergenic
1157570773 18:48710541-48710563 CTTTTCTGTTGGAGGAGGGATGG + Intronic
1157716054 18:49888167-49888189 ATTCTTTCTTGGGGGAGTAAGGG + Intronic
1158074241 18:53510322-53510344 ATTTTTTCTGGTGGTAGGGAGGG + Intronic
1158395356 18:57075221-57075243 ATTTTGAGCTGGGGGTGGGAGGG + Intergenic
1159613048 18:70547470-70547492 ATTATGTATTGGGGAAAGGAGGG + Intergenic
1161725687 19:5927254-5927276 ATTGTGTGGTGGGGAAGGGATGG - Intronic
1161915535 19:7225391-7225413 ATTTTGGCTTGGTGGTGGGGCGG - Intronic
1162357194 19:10193716-10193738 TTTGGGTCTTTGGGGAGGGATGG - Intronic
1163008953 19:14412907-14412929 AGTTTGCCGTGGGTGAGGGAGGG - Intronic
1163211843 19:15846610-15846632 CTTGTGTCTTGGGGGAAGAAAGG + Intergenic
1163713631 19:18861658-18861680 ATTTTTTTTTGGTGGAGGCAGGG - Intronic
1163846550 19:19641556-19641578 ATTTTTTCTTTTGGTAGGGATGG + Intronic
1164755337 19:30685102-30685124 ACTTTGTGTTGGTGGGGGGAGGG + Intronic
1166019547 19:40013587-40013609 TTTCTGTGTTGGGGCAGGGATGG - Intronic
1166363738 19:42268369-42268391 AGTTTGGATTGGGGGAGGGGAGG - Intergenic
1167336970 19:48892506-48892528 TTTTTTTTTTGGGGGGGGGACGG + Intronic
1168093034 19:54098098-54098120 TATTTGTCTTGGGGTAAGGAAGG + Intronic
1168123328 19:54267354-54267376 TTTTTGGAGTGGGGGAGGGAGGG + Intronic
1168270258 19:55245898-55245920 AGCTTGTCTTGGGGGTGGTAAGG - Intronic
925701178 2:6640013-6640035 AGCTTGTCTTGGGGTAGGGAGGG - Intergenic
926458669 2:13100460-13100482 ATTTTCTGTAGGGGAAGGGAAGG + Intergenic
927514203 2:23662578-23662600 CTCTTGCCTTTGGGGAGGGAGGG - Intronic
928179311 2:29056811-29056833 TTCTTCTCTGGGGGGAGGGATGG - Exonic
928666289 2:33553685-33553707 ATTTTGTCTTAGGGACAGGAAGG - Intronic
928897014 2:36277558-36277580 ATTCTGTCTTGTTTGAGGGAGGG + Intergenic
928915735 2:36468394-36468416 ATTTTGTTGTGGCGGAGGGATGG + Intronic
928915920 2:36470245-36470267 AATTTGTTTTGGTGGAGGGATGG + Intronic
929565923 2:42984748-42984770 ATTATGTGTTAGGGGAGGGTGGG + Intergenic
929895137 2:45953263-45953285 ATTTTGTCTTGGGGAAGATGAGG + Intronic
930367783 2:50462905-50462927 ATTCTATTTTGGGGGAGGGAAGG + Intronic
933940146 2:87238436-87238458 GCTGTGTTTTGGGGGAGGGAGGG + Intergenic
934188892 2:89767402-89767424 AGATTATCTTGGGGGAGGCAGGG - Intergenic
935702641 2:105825560-105825582 ATTCTGGCTTGGGGGATGGTGGG + Intronic
935874999 2:107496886-107496908 ATGAAGGCTTGGGGGAGGGATGG - Intergenic
936352994 2:111727342-111727364 GCTGTGTTTTGGGGGAGGGAGGG - Intergenic
936770552 2:115907430-115907452 TTTTTTTTTTGGGGGGGGGACGG - Intergenic
936911831 2:117601619-117601641 GTTTTAGCTAGGGGGAGGGAGGG + Intergenic
937098486 2:119250871-119250893 ATCTCGTCCTGCGGGAGGGATGG - Intronic
937132016 2:119520936-119520958 ATTTTTTCTGGGGGTAGGAAGGG - Intronic
938575022 2:132595638-132595660 ATTCTGTGTTGGGGGAGAGTGGG + Intronic
938589737 2:132724802-132724824 TATTTGCGTTGGGGGAGGGAGGG - Intronic
939386599 2:141508079-141508101 CTTTTTTTTTGGGGGGGGGATGG - Intronic
939488989 2:142854216-142854238 AATTTTTCTTGGGGGAGAGCTGG - Intergenic
939756522 2:146119104-146119126 AGTTTGTTTTTGGGGAGTGATGG - Intergenic
941009895 2:160287440-160287462 ATTTTAAGTTGGGGGAGGGGAGG - Intronic
942265705 2:174223297-174223319 ATTTTTTTTGGGGGGAGGGGTGG - Intronic
942782175 2:179657085-179657107 ACTCTGTATTGGGGCAGGGAAGG + Intronic
943186378 2:184612440-184612462 TTTTTTTTTTGGGGGGGGGACGG + Intronic
944044296 2:195390941-195390963 TTGGTGTCTTGTGGGAGGGAGGG - Intergenic
944565462 2:200985749-200985771 ATTTCAATTTGGGGGAGGGAGGG - Intronic
944745179 2:202648516-202648538 TTTTTGTTTTGGGGGGGGGGTGG - Intronic
945976716 2:216276842-216276864 ATCATCTGTTGGGGGAGGGAGGG + Intronic
946510359 2:220349280-220349302 ATTTTGTCTTTGGTGAATGATGG + Intergenic
946834386 2:223757701-223757723 ATCTTTTCTTTGGGGAGGAAAGG + Intronic
946852773 2:223923178-223923200 ATTTAGTCTTGGAAGAGGAAGGG - Intronic
946874251 2:224111831-224111853 ATGTTTTCATGGGGAAGGGAGGG - Intergenic
947797154 2:232901755-232901777 CTTTTGCCTGGAGGGAGGGAGGG + Intronic
1168831153 20:845911-845933 ACCTTGTATTGGGGGAGGGGAGG - Exonic
1169582506 20:7040045-7040067 ATTTTTTGTTGGGGGAGGTGGGG + Intergenic
1170579587 20:17687764-17687786 ATCTTGTCTTGGGAAAAGGAAGG + Intergenic
1171937876 20:31293250-31293272 TTTGTGTGCTGGGGGAGGGAGGG + Intergenic
1172226410 20:33307907-33307929 TTTTTTTTTTGGGGGGGGGATGG - Intronic
1173237966 20:41265620-41265642 AATTTGTCTTGGGGGAGGTGTGG - Intronic
1173763011 20:45580895-45580917 ATTCTGTCTTTGGGGTAGGAAGG - Intergenic
1174309054 20:49636233-49636255 ATTTTTTTTTGGAGGGGGGAGGG - Exonic
1175167697 20:57056814-57056836 CTTTTGTCTTGTGGGAAGAAAGG + Intergenic
1175346325 20:58279314-58279336 AGGTTGTAGTGGGGGAGGGAGGG + Intergenic
1175569238 20:60006534-60006556 TCTTTGTGTTGGGGGAGAGAGGG - Intronic
1177880429 21:26687961-26687983 ATTTTTGCCTGGAGGAGGGAGGG + Intergenic
1177882164 21:26707228-26707250 AATGGGTCTTGGGGGAGGGAGGG - Intergenic
1179829063 21:43984684-43984706 TTTTTTTTTTGGGGGGGGGAGGG + Exonic
1180191312 21:46164829-46164851 TTTTTGCCTTGGTGGGGGGATGG - Intronic
1180301966 22:11043558-11043580 ATTTTTTTTTGAGGGGGGGAAGG - Intergenic
1180341890 22:11626697-11626719 TTTTTTTTTTGGGGGGGGGACGG + Intergenic
1182005551 22:26956556-26956578 AATATGTGCTGGGGGAGGGAGGG - Intergenic
1182289955 22:29269054-29269076 AATTGGTTTTGGGGGAGGGGAGG - Intronic
1182592681 22:31394195-31394217 CTGCTGGCTTGGGGGAGGGAGGG - Intergenic
1182665390 22:31955189-31955211 ATTTTGGTTTGGGAGAGGGCTGG + Intronic
1182666044 22:31960809-31960831 ATTTTTTCTGGGGGGGGGGGGGG - Intergenic
1183343563 22:37294948-37294970 ACTTTGGGTTGGGGGAGGGGAGG - Intronic
1183790592 22:40065316-40065338 ATTTTGTTTTTGTGGAGGTAGGG + Intronic
1184414586 22:44344880-44344902 CTGTTGGCCTGGGGGAGGGAGGG - Intergenic
1184666983 22:45994469-45994491 CTTTTCTGTTGGGGGAGGGGAGG + Intergenic
1184981697 22:48100091-48100113 ATATTGCCCTGGTGGAGGGAAGG - Intergenic
1185338866 22:50282874-50282896 ACTTCGTCCTGGGGGAGGGAGGG + Exonic
1185379941 22:50503692-50503714 CTTTTCTCCTGTGGGAGGGAGGG + Exonic
949876018 3:8626541-8626563 ATTTAGTGGTGGGGGAGGGGGGG - Intronic
950363996 3:12470212-12470234 ATTTTGTCTTGGCTGATGGCTGG + Intergenic
950566750 3:13773838-13773860 AGTGTGTCTTGGAGGAGGGCGGG + Intergenic
950648732 3:14393890-14393912 TTGTTGTGTTTGGGGAGGGAGGG + Intergenic
950889390 3:16389488-16389510 TTTTTTTCGGGGGGGAGGGAAGG + Intronic
951202429 3:19890268-19890290 ATCAGGGCTTGGGGGAGGGAGGG - Intronic
951229541 3:20161001-20161023 TTTATGTGTTGGGGGAGAGATGG - Exonic
953568170 3:44051018-44051040 TTGCTGTCTTGGGGTAGGGAGGG - Intergenic
954050835 3:47975749-47975771 ATGTTTTATTTGGGGAGGGAAGG - Intronic
956339373 3:68204499-68204521 GTTGTGTCCTGAGGGAGGGAGGG + Intronic
956582398 3:70829120-70829142 ATTTGGCCATGGGGGTGGGAGGG + Intergenic
957226290 3:77452101-77452123 TTTTTGTCTAGGGGGAAAGATGG - Intronic
957262874 3:77922954-77922976 ATATTGTCTTTGGTTAGGGAAGG - Intergenic
957321568 3:78637975-78637997 GTTTTTTTTTGGGGGGGGGAGGG + Intronic
957341374 3:78901869-78901891 ATTTACTCCTGGGGTAGGGAGGG + Intronic
957566589 3:81891903-81891925 ATCTTTTCTTGTGGGAGGTATGG + Intergenic
959140464 3:102480355-102480377 CCTTTGTCTTGGGGGAGGGTTGG + Intergenic
960426943 3:117520431-117520453 ATTTTCTCTTTAAGGAGGGAAGG - Intergenic
961010640 3:123433448-123433470 ATTTTCTTTTGGGGATGGGACGG - Intronic
961423542 3:126827443-126827465 AGGTTGCCTTGGTGGAGGGAAGG + Intronic
961560907 3:127729427-127729449 ATTTTGTCTTGGTGTAGGGTAGG + Intronic
961617443 3:128193965-128193987 ATCTTATCTTGGGGGATAGAGGG + Intronic
961723477 3:128910820-128910842 GGCATGTCTTGGGGGAGGGAAGG + Intronic
963013019 3:140792468-140792490 ATTTTGTCTATGGGAAGAGATGG - Intergenic
963408195 3:144895317-144895339 CTTTTTTCTTGGGGGAGGTGGGG + Intergenic
964011220 3:151894298-151894320 ATTATGTCATGAGGGTGGGATGG + Intergenic
964129957 3:153275938-153275960 GCTGTGTCTTGGGGGAAGGAGGG + Intergenic
964786687 3:160403003-160403025 ATTTTATTTTGGGGGAGTGGTGG + Intronic
964801284 3:160561838-160561860 TTTTCTTTTTGGGGGAGGGAAGG - Intronic
965688746 3:171333144-171333166 AGTTGGTGTTGGGGGTGGGAGGG + Intronic
966013264 3:175108908-175108930 TTTTTCTCTTGGGGGTGGCATGG + Intronic
966438928 3:179922034-179922056 ATTATGTGTTGGGGGTGGGGGGG - Intronic
967538530 3:190636544-190636566 ATTTTTTTTTGGTAGAGGGACGG + Intronic
968657102 4:1783427-1783449 ATTTTGTCTCGGGGGAGCTAAGG + Intergenic
969046303 4:4339185-4339207 ATTCTGTCTGGCCGGAGGGAGGG - Intergenic
970199861 4:13593226-13593248 AAATTGGATTGGGGGAGGGAGGG - Intronic
970629302 4:17923651-17923673 ATCTTTTTTTGGGGGAGGGTGGG - Intronic
970671259 4:18398988-18399010 TTTTTGTCTTGGGAAAGGGGCGG - Intergenic
971321836 4:25611995-25612017 TTTTTGTGGTGGGGGCGGGATGG - Intergenic
971521432 4:27556806-27556828 TTTTTTTGTTGGGGGGGGGAAGG + Intergenic
971638801 4:29101399-29101421 ATTTTTTTTTGGGGGGGGAATGG + Intergenic
971737767 4:30478788-30478810 ATTGTATGTTGGGGGAGAGAAGG + Intergenic
971806483 4:31364936-31364958 ATTTTGACTTGGAGTAGAGAAGG - Intergenic
971894047 4:32566967-32566989 AATTTGGATTGGGGCAGGGATGG + Intergenic
972894884 4:43607770-43607792 ATTTTGTCTTGGTAGAAGGGAGG + Intergenic
973137908 4:46729949-46729971 ATTTTGCCTGGAGGGAGAGATGG + Intergenic
973815629 4:54616619-54616641 TTGTTGATTTGGGGGAGGGAAGG - Intergenic
973880813 4:55269497-55269519 AATTTGTGTTGGGGGAGGAGGGG + Intergenic
974880992 4:67757078-67757100 AGTTTGTCATGGGGGAGCGGTGG + Intergenic
974943221 4:68493468-68493490 ATTTTTTTGGGGGGGAGGGATGG + Intronic
975753919 4:77553037-77553059 ATTTTGGCTTGGGGGTGGAGTGG + Intronic
975904084 4:79188838-79188860 ATTTTGTCTTGGGTGAGCTCAGG - Intergenic
975989637 4:80244088-80244110 ATTTAGTTATGGGGGAGGGAGGG + Intergenic
976505264 4:85838798-85838820 AAGTTAGCTTGGGGGAGGGAGGG - Intronic
976679320 4:87737826-87737848 ATTCTTTTTTGGGGGAGGGCAGG + Intergenic
976786291 4:88825218-88825240 TTTTTTTTTTGGGGGGGGGATGG + Intronic
976965670 4:91037188-91037210 ATTGTGTGTTGGGGGACAGAAGG - Intronic
977628266 4:99212977-99212999 GTATTATCTTGGAGGAGGGAAGG - Intronic
978059171 4:104314573-104314595 ATTTTTTTTTTGGGGGGGGATGG - Intergenic
978103565 4:104873676-104873698 ATTTTCTGTTGGGGGAGAAAAGG + Intergenic
978399422 4:108314908-108314930 ATGTTGTGTCGGGGGAGGCAGGG + Intergenic
979166382 4:117536843-117536865 ATTTTTTTTTGGGGGGGGGTTGG - Intergenic
979171003 4:117601143-117601165 ATTTTTTTTTGGCGGGGGGAGGG + Intergenic
979919052 4:126476172-126476194 ATTTTGTCTTTGCAGAGGGTAGG + Intergenic
980825975 4:138073669-138073691 ATCTTATCTGGGGAGAGGGAAGG - Intergenic
981265526 4:142778636-142778658 AGTGTGTCTTGGGGGTTGGAAGG + Intronic
982111397 4:152059151-152059173 ATTCTGTATGGGGGGAGGGTGGG + Intergenic
982275402 4:153632304-153632326 TTTTTGGGTGGGGGGAGGGATGG - Intronic
982782719 4:159507764-159507786 ATTTTCTCTGGGAGTAGGGAAGG + Intergenic
983224208 4:165071293-165071315 TTTTTTTTTTGGGGGGGGGACGG + Intergenic
983377147 4:166944537-166944559 TTTTTTTCTTGAGGGAGGGGTGG + Intronic
983409744 4:167381137-167381159 ACTTCCTCATGGGGGAGGGAGGG - Intergenic
983870982 4:172825246-172825268 ATGGAGTCTTGCGGGAGGGAGGG + Intronic
984292398 4:177812200-177812222 ATTTTGTCTTGGAGAAGGGCTGG - Intronic
984467176 4:180115228-180115250 TTTTTTTTTTGGGGGGGGGATGG - Intergenic
984985253 4:185322420-185322442 ATTTGGTCTTGGGGAAGGTGGGG + Intronic
987404700 5:17512717-17512739 ATTGTGCATTGTGGGAGGGATGG + Intergenic
987412309 5:17626440-17626462 ATTGTGCATTGTGGGAGGGATGG + Intergenic
987438896 5:17932095-17932117 ATTTTGTTTTTTGTGAGGGAGGG - Intergenic
987454761 5:18129753-18129775 ATTCTGGGTTGGGGCAGGGATGG + Intergenic
987458634 5:18178162-18178184 ATTTAGTCCTGGTGGAGGGCTGG + Intergenic
987690674 5:21262587-21262609 ATTTTGTCTTGGGCCAGGTGAGG - Intergenic
987944371 5:24585386-24585408 TTTGTGTGTTGGTGGAGGGAAGG - Intronic
988060528 5:26161798-26161820 ACTTTTTCTAGGGGGTGGGAAGG + Intergenic
989948934 5:50274017-50274039 GTTTTGTTTTGGGGGGGGGTTGG + Intergenic
990332423 5:54740842-54740864 TTTTTGTCTTGACTGAGGGAGGG - Intergenic
991106213 5:62844769-62844791 ATTGTGTATTGGGTCAGGGAAGG - Intergenic
991334447 5:65531161-65531183 ATATTTTTCTGGGGGAGGGAGGG - Intronic
992558169 5:77923856-77923878 CTTTTATCTTGAAGGAGGGAGGG - Intergenic
992691118 5:79240698-79240720 AGATTATATTGGGGGAGGGAGGG + Intronic
993269655 5:85778038-85778060 ATTTTCTTTTGGGGTGGGGAGGG - Intergenic
993513989 5:88806534-88806556 ATTTAGTTGTGGGGGAGGGTGGG - Intronic
995523406 5:113031730-113031752 GTTTTGTCTTGTGGAAGGGCTGG - Intronic
998240049 5:140433051-140433073 TTTTTTTTTTGGGGGGGGGAAGG - Intronic
998967705 5:147558782-147558804 TTCTTGTGTTTGGGGAGGGAGGG - Intergenic
999298792 5:150477470-150477492 TGTGTGTGTTGGGGGAGGGAGGG + Intergenic
999299970 5:150485370-150485392 GGTGTGTGTTGGGGGAGGGAGGG + Intergenic
1000517866 5:162262129-162262151 ATTTGGTATTGGGTGAGGGTGGG - Intergenic
1001640575 5:173240946-173240968 ATTTGGGGTGGGGGGAGGGATGG + Intergenic
1001726571 5:173907524-173907546 GTTTTCTTTTGGGGGAGGGGAGG - Intronic
1003703842 6:8501091-8501113 TTATTTTTTTGGGGGAGGGATGG - Intergenic
1004058887 6:12171160-12171182 GCTTTTTCTTGGGAGAGGGAGGG - Intergenic
1004183291 6:13399166-13399188 TTTTGGTGGTGGGGGAGGGAGGG + Intronic
1004469321 6:15915282-15915304 ATTTTCTCTTGGGGGACTGTGGG - Intergenic
1004654346 6:17644355-17644377 ATTTTTACTTGGGGGTGAGATGG - Intronic
1005865090 6:29931366-29931388 AGTTGGTGTGGGGGGAGGGAGGG + Intergenic
1006951399 6:37823792-37823814 ATTTTTTTTTGGGGGGGGGTAGG + Intronic
1007152029 6:39703046-39703068 ATTTTGTCTTGGTGGCCGGGGGG - Intronic
1007152618 6:39709287-39709309 ATTGTGTGTTGTCGGAGGGATGG + Intronic
1007211655 6:40197374-40197396 ATGTGGTCTTAGGGGAGGAATGG - Intergenic
1007366361 6:41396860-41396882 ATTTTGTGGTGGGGGTGGGAGGG - Intergenic
1007651755 6:43427013-43427035 ACTTTTTTTTGGGGGGGGGACGG - Intergenic
1008102802 6:47410519-47410541 ATTTTGTATTGGGGTAGTTAGGG - Intergenic
1008142389 6:47846806-47846828 TTTTTGTCTTGTGGGAAAGAAGG - Intergenic
1008324845 6:50165574-50165596 GTTTTGTTTTGGGGGGGGGGGGG + Intergenic
1008520317 6:52356790-52356812 ATTTTATCCTGGGGGAGAGAGGG - Intergenic
1008838225 6:55864361-55864383 ATGTCATCTTGTGGGAGGGAGGG + Intronic
1010021902 6:71170230-71170252 ACTTTGTCTAGGGGGAGAAAAGG - Intergenic
1010073566 6:71773078-71773100 ATTTTGTCTTGGGCCAGGCATGG - Intergenic
1010258907 6:73792894-73792916 ATTTTGTCTTAGGTAAGTGATGG + Intronic
1010489543 6:76458996-76459018 AGTTTGGGTTGGGAGAGGGAGGG - Intergenic
1010676094 6:78745429-78745451 AGTTTTTCTGGGGGCAGGGATGG + Intergenic
1011240640 6:85268000-85268022 TTTTTGCCTTGGGGAAGAGAAGG - Intergenic
1011508318 6:88072335-88072357 TATTTGTTTTGGGGGAGGGAGGG + Intergenic
1011561460 6:88621503-88621525 ATTTTGTTTTTGGGGAGGTGGGG - Intronic
1011632465 6:89340389-89340411 AAGTGGTCTTCGGGGAGGGAGGG - Intronic
1011831945 6:91385091-91385113 ATTTTGTTGTGGGGTAGAGATGG - Intergenic
1011946478 6:92910901-92910923 ATTTTGAATTGGTGGTGGGATGG + Intergenic
1012182923 6:96177292-96177314 ATTTTACCTTGGGGGTGGGTAGG - Intronic
1012569713 6:100708669-100708691 ATTGTGTTTTGGGGGATGGAGGG - Intronic
1014817040 6:125947472-125947494 ACTTTGCCTTGGGGGTGGCAAGG - Intergenic
1015556237 6:134464287-134464309 ATTTTGTCTTTGGGTAGAGATGG - Intergenic
1016016924 6:139196083-139196105 ATATTTTCTTTGGGGAGGAAAGG + Intergenic
1017129008 6:151092067-151092089 AATGTGTCTTGGGGGTGAGAAGG + Intronic
1017341875 6:153333490-153333512 ATCATCTCTTGTGGGAGGGAAGG + Intergenic
1018345522 6:162895098-162895120 ATTTTTTTTTGGGGGCGGGGGGG - Intronic
1018825844 6:167407426-167407448 CTTATGGCATGGGGGAGGGAGGG + Intergenic
1020788008 7:12593012-12593034 TTTTTGTCTTGTTGAAGGGATGG + Intronic
1021098676 7:16562767-16562789 GTTTTGTCTTTTGGGAGGGGTGG - Intronic
1021239194 7:18179564-18179586 ATTTTTCCTTAGGAGAGGGAGGG - Intronic
1021255873 7:18391378-18391400 TTTTTTTTTTGGGGGGGGGATGG - Intronic
1021287600 7:18800540-18800562 ATTTCTTCTTGGGCAAGGGATGG + Intronic
1021687520 7:23201753-23201775 TTTTTTTGTTGGGGGAGGGCAGG - Intergenic
1021708770 7:23394474-23394496 TTGTTGTTTTGGGGGAGGGTAGG - Intronic
1022092811 7:27118480-27118502 ATTTAGCTTTGGGGGAGGGTAGG + Intronic
1022692596 7:32671292-32671314 ATTTTGTCATGTGAGAGGGGAGG + Intergenic
1022920271 7:35005835-35005857 ATTTTGTCATGTGAGAGAGAAGG + Intronic
1023635940 7:42210342-42210364 ATTTTAACTTGGGGGGGGGGGGG - Intronic
1024310156 7:47961761-47961783 TTTTTTTCTTGGGGGAGACAGGG - Intronic
1026528323 7:71174901-71174923 TTTCTGTCTTTGGGGAGCGATGG + Intronic
1026957904 7:74389332-74389354 ATGTTATCTTGGGGCAGAGAGGG + Intronic
1027003013 7:74667518-74667540 TTTTTTTGTGGGGGGAGGGACGG + Intronic
1027325943 7:77049211-77049233 TTTTTTTTTTGGGGGGGGGATGG - Intergenic
1027426862 7:78069841-78069863 ACTTTGTGTTGGGGCAAGGAAGG + Intronic
1027547091 7:79541059-79541081 ATATTGGCTTGGGGTATGGATGG - Intergenic
1027831727 7:83185256-83185278 ATTCTGTCTTGGGGGAGGTGGGG + Intergenic
1027958207 7:84910019-84910041 ATTTTCTTTTGGGGCAGGGGAGG - Intergenic
1028253679 7:88565943-88565965 ATGTTGTCTTTGGGGGGGGGGGG + Intergenic
1029335401 7:99894660-99894682 TTTTTTTTTTGGGGGGGGGATGG - Intronic
1029718158 7:102344562-102344584 TTTTTTTTTTGGGGGGGGGATGG - Intergenic
1029769290 7:102643352-102643374 ATTTTTTTTTGGGGGGGGCAGGG + Intronic
1030711370 7:112753967-112753989 ATTGTGTGTTAGGGGAGGAAGGG - Intergenic
1030868296 7:114726641-114726663 TTTTTTTTTTGGTGGAGGGAAGG + Intergenic
1031044730 7:116875083-116875105 TTTTTTTGTGGGGGGAGGGATGG - Intronic
1033459500 7:141532593-141532615 GTTGTGTTTTGGAGGAGGGAGGG + Intergenic
1034410640 7:150940060-150940082 ATTGAGTTTTGGGGGTGGGAGGG + Intergenic
1034702258 7:153106723-153106745 AGTCTATCATGGGGGAGGGAGGG + Intergenic
1036120678 8:6013935-6013957 TTTTTTTCTTGGGGGTGGGGAGG - Intergenic
1037520422 8:19675495-19675517 ACTCTGTCTGGGGGGAGGGATGG - Intronic
1038075408 8:24067380-24067402 ATTTTTTTTGGGGGGGGGGATGG + Intergenic
1038144371 8:24881137-24881159 AGTTTGTCTTAGGGAAGTGAAGG - Intergenic
1038223518 8:25633312-25633334 GTTGGGTATTGGGGGAGGGAAGG - Intergenic
1038409161 8:27344840-27344862 AATTTTTCTTGGAGGAAGGAAGG + Intronic
1038468421 8:27788671-27788693 ATTTTGTCTTGGGGGAGGGAAGG + Intronic
1038536551 8:28357273-28357295 CATTTTTCTTGGGGGAGGGGTGG - Intronic
1038929975 8:32182671-32182693 ATTTTGTCTTGGGAAAAGGCAGG + Intronic
1039189255 8:34953415-34953437 TCTGTGTCTTGGGGAAGGGATGG - Intergenic
1039996518 8:42539095-42539117 ATTTTCTCTTTGGGGAGGGGAGG - Intronic
1041660136 8:60393285-60393307 ACTTTGTCTTGGGGAAAGGTGGG - Intergenic
1042036411 8:64539063-64539085 ATTCTGTCTAGGGGCAAGGAAGG - Intergenic
1042239955 8:66653895-66653917 ATTTGTTCTTGGAGGAGGAAGGG - Intronic
1044353207 8:91191042-91191064 TTTTTGACTTGGGGGGGGGGGGG - Intronic
1044428791 8:92084669-92084691 ATTCTATCTTTGGGGAGGAAGGG + Intronic
1044766828 8:95585181-95585203 CTTTTTTTTTGGGGGGGGGATGG + Intergenic
1045307165 8:100968207-100968229 TTTTTTTTTTGGGGGGGGGACGG + Intergenic
1045985735 8:108248017-108248039 ATTTTTTCTGGGGGGGGGGGCGG + Intronic
1046441263 8:114257979-114258001 ATTTTGTATTTGATGAGGGATGG - Intergenic
1047556335 8:125934901-125934923 ATTTGGTCTTGGGGAAGCTAGGG - Intergenic
1047783787 8:128133955-128133977 GCTTTGTTTTTGGGGAGGGAGGG + Intergenic
1047993378 8:130310129-130310151 AGTTTTTTTTGGGGGGGGGAGGG + Intronic
1048821178 8:138382184-138382206 ATTTTGGCTGGGAGGAGGGCAGG - Intronic
1048825044 8:138416140-138416162 ATTTTGTCCTGGGGGATCAAGGG - Intronic
1048915005 8:139174151-139174173 TTTCTGTCTTGGGGAAAGGAGGG + Intergenic
1049956880 9:701521-701543 ATTCTTTGTTGGGGGAAGGAGGG + Intronic
1050092086 9:2025431-2025453 ATTTTGTGTTAGGAGAAGGAGGG - Intronic
1050562839 9:6852399-6852421 CTTGTGACTTGGGGGAGTGAAGG - Intronic
1053651038 9:40170237-40170259 ATTTTCCTGTGGGGGAGGGATGG - Intergenic
1053901427 9:42799589-42799611 ATTTTCCTGTGGGGGAGGGATGG - Intergenic
1054533542 9:66205966-66205988 ATTTTCCTGTGGGGGAGGGATGG + Intergenic
1054781419 9:69169360-69169382 TTTTTTTTTTGGGGGGGGGATGG + Intronic
1054900746 9:70367077-70367099 ATTCTGTTTTGGGGGGTGGAAGG - Intergenic
1055022159 9:71681997-71682019 ACTTTGTCTTGAGGAGGGGAAGG - Intergenic
1055671796 9:78614710-78614732 ATGTTGTCTTGGAGCAGAGAGGG - Intergenic
1055710328 9:79054099-79054121 ATTCTGTCTTGGGGAAGACAGGG + Intergenic
1055989192 9:82087134-82087156 ACTTTGTCATTGGTGAGGGAGGG + Intergenic
1057948868 9:99353771-99353793 CCTTTCTCTTGGGGGAGGGGAGG + Intergenic
1058708213 9:107655199-107655221 ATATGGTGTTGGGGGAAGGAAGG + Intergenic
1058734500 9:107881956-107881978 GTTTTGTCTTGGGTGAGAAAAGG - Intergenic
1059360306 9:113736959-113736981 ATTTTTTTTTGCGGGGGGGATGG + Intergenic
1059945737 9:119406595-119406617 ATTTTATTTTGGGGGCGGGCAGG + Intergenic
1060593983 9:124837185-124837207 ATTTTTAGTTGGGGGCGGGAGGG - Intergenic
1060710720 9:125861125-125861147 AATTTTTTTTGTGGGAGGGAGGG - Intronic
1061079324 9:128360759-128360781 ATGATGTCTTGGGTGAGGGTAGG + Exonic
1061980524 9:134100643-134100665 AGTGTGTCTAGGGGCAGGGATGG - Intergenic
1062068633 9:134542843-134542865 AATTTGTTTTGGGGTAAGGAGGG + Intergenic
1203655691 Un_KI270752v1:22141-22163 ATTTTGTTTTGAGGGAGGTGTGG + Intergenic
1185512566 X:674368-674390 ATCTGTTCTTGGGAGAGGGATGG - Intergenic
1185749200 X:2597158-2597180 CTTTTGTGTTTGGGGAGGGTGGG + Intergenic
1186182776 X:6989062-6989084 ACTCAGTCTTGGGGGAGAGATGG - Intergenic
1186217223 X:7313049-7313071 ACCTTGACTTGGGAGAGGGATGG - Intronic
1187849385 X:23576438-23576460 ATTATGTCTTTTGGGAGTGAGGG - Intergenic
1188269881 X:28126022-28126044 GTTTTTTCTTGAGGGAGGGAGGG + Intergenic
1188538055 X:31219271-31219293 CTTCTGTCCTGGGGTAGGGAGGG - Intronic
1188737909 X:33741474-33741496 ATTTTTTTTGGGGGGGGGGAGGG + Intergenic
1188801912 X:34542826-34542848 ATTTTGTCTTTTGCTAGGGAAGG + Intergenic
1189631261 X:42956110-42956132 TATGTGTCTTGGGAGAGGGAGGG + Intergenic
1189757741 X:44287932-44287954 ACTTTGTCTTGGGAGACAGAGGG + Intronic
1190789477 X:53685895-53685917 TTTCTCTGTTGGGGGAGGGAGGG - Intronic
1191637620 X:63394349-63394371 GTTTTGTTTTGGGGGGGGCAGGG + Intergenic
1192790878 X:74380708-74380730 AGTTTGTAGTGGAGGAGGGAAGG - Intergenic
1193130039 X:77910430-77910452 CTTTTGTCGTGGGGGCGGGGTGG + Intergenic
1194139354 X:90190877-90190899 ATTTTGATTTGGGGTAGGCAGGG - Intergenic
1195258638 X:103112419-103112441 AATTTGACTCGGGGGAGGAAGGG - Intergenic
1195309293 X:103615219-103615241 ATTTTGCCTGAGGGAAGGGAGGG + Intronic
1195390151 X:104353166-104353188 ATTTGTTCTTGGGGTAGGGATGG + Intergenic
1195618412 X:106930643-106930665 ATTGAGGGTTGGGGGAGGGAGGG - Exonic
1196721999 X:118863190-118863212 ATATTGCAGTGGGGGAGGGAGGG + Intergenic
1198017781 X:132629401-132629423 ATTTTGTCTTTGGTTAGAGAGGG - Intronic
1198102997 X:133438010-133438032 ACTTTACCTTGGGGGAGGGGAGG + Intergenic
1198275091 X:135092800-135092822 ACTTTGTGTTGGTGGAGGGAAGG - Intergenic
1198987343 X:142470544-142470566 CTTATGTGTTGGGAGAGGGAAGG + Intergenic
1200210947 X:154346358-154346380 GGTGTGGCTTGGGGGAGGGAAGG + Intergenic
1200219905 X:154385734-154385756 GGTGTGGCTTGGGGGAGGGAAGG - Intergenic
1200485099 Y:3759812-3759834 ATTTTGATTTGGGGTAGGCAGGG - Intergenic