ID: 1038469804

View in Genome Browser
Species Human (GRCh38)
Location 8:27805606-27805628
Sequence CCTACCACCCAGATCTTGGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1038469801_1038469804 -4 Left 1038469801 8:27805587-27805609 CCTAATGGCAATGAGCACACCTA 0: 2
1: 7
2: 40
3: 163
4: 382
Right 1038469804 8:27805606-27805628 CCTACCACCCAGATCTTGGTTGG No data
1038469800_1038469804 -3 Left 1038469800 8:27805586-27805608 CCCTAATGGCAATGAGCACACCT 0: 1
1: 1
2: 5
3: 80
4: 242
Right 1038469804 8:27805606-27805628 CCTACCACCCAGATCTTGGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1038469804 Original CRISPR CCTACCACCCAGATCTTGGT TGG Intronic
No off target data available for this crispr