ID: 1038477035

View in Genome Browser
Species Human (GRCh38)
Location 8:27875758-27875780
Sequence ATCTTTCTAAAACGAGTGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 103
Summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 96}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1038477035_1038477038 2 Left 1038477035 8:27875758-27875780 CCAGGCACTCGTTTTAGAAAGAT 0: 1
1: 0
2: 1
3: 5
4: 96
Right 1038477038 8:27875783-27875805 CTAACAGTTTGAGACCAGCCTGG No data
1038477035_1038477039 3 Left 1038477035 8:27875758-27875780 CCAGGCACTCGTTTTAGAAAGAT 0: 1
1: 0
2: 1
3: 5
4: 96
Right 1038477039 8:27875784-27875806 TAACAGTTTGAGACCAGCCTGGG 0: 3
1: 177
2: 4108
3: 29453
4: 49019

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1038477035 Original CRISPR ATCTTTCTAAAACGAGTGCC TGG (reversed) Intronic
905614460 1:39385366-39385388 ATCTATCTAAAAGCAGTGTCAGG - Intronic
910554499 1:88516128-88516150 CACTTTCTAAAAGGAGGGCCTGG + Intergenic
910574687 1:88747528-88747550 ATCTTTCTCAAACGAGTGTCAGG - Intronic
914837027 1:151215619-151215641 ATCTTTTAAAAAAGAATGCCGGG - Intronic
916257352 1:162802837-162802859 AACTTTCTAAAATGAGTTCTAGG + Intronic
920741407 1:208584583-208584605 ATGTTTGGAAAACGAGGGCCTGG - Intergenic
921500387 1:215895284-215895306 ATCTTTCTATCACCAGTGTCTGG - Intronic
922033939 1:221830269-221830291 ATCTTCCTAGATCCAGTGCCTGG - Intergenic
923993439 1:239465489-239465511 ATCTTTCTAAACTGACTGCGTGG - Intronic
1064528423 10:16282692-16282714 ATCTTACTAAAATGACTGACTGG + Intergenic
1066723804 10:38368530-38368552 AACTTTCTAAAATGAGTTCTAGG + Intergenic
1067458959 10:46443439-46443461 ATATTTCTAAAAATACTGCCAGG + Intergenic
1067628238 10:47941193-47941215 ATATTTCTAAAAATACTGCCAGG - Intergenic
1077878496 11:6327925-6327947 ATCATTCTAAATCAAATGCCTGG + Intergenic
1079000101 11:16745691-16745713 AACTATATAAAACAAGTGCCAGG + Intronic
1081408029 11:42720807-42720829 ATCTTTGTAATCCCAGTGCCTGG - Intergenic
1085043242 11:73339041-73339063 ATCTTTGTCAAGAGAGTGCCTGG - Intronic
1097733772 12:63158634-63158656 ATTTTTCTAAAATGCTTGCCTGG - Intergenic
1100158651 12:91831993-91832015 CTCTTTCTTAAGGGAGTGCCTGG - Intergenic
1100877538 12:98978846-98978868 AAATTTTTAAAACGAGGGCCGGG + Intronic
1101003868 12:100382811-100382833 AATTTTCTCAAACCAGTGCCTGG - Intronic
1101018051 12:100522524-100522546 AACTTTTTAAAAAGAGTGCCAGG - Intronic
1107213185 13:37883581-37883603 AACTTTCTTAAAAGAGAGCCAGG - Intergenic
1107431673 13:40345937-40345959 CTCTTTCTATAAGGGGTGCCTGG + Intergenic
1107614282 13:42148602-42148624 ATCTTCCTAAAATGAGTATCTGG + Intronic
1108966386 13:56308434-56308456 ATTTTTCTAAAAAGTGAGCCAGG - Intergenic
1109006142 13:56880559-56880581 ATCTTTATAAAAGGAGTGGAAGG + Intergenic
1111657730 13:91174447-91174469 ATCTTTATAGACAGAGTGCCTGG - Intergenic
1113477649 13:110596207-110596229 AGCTTTCTAAGATGAGAGCCAGG - Intergenic
1116617011 14:47153144-47153166 ATCTTTCTAAAGCGAAAGCCTGG - Intronic
1118542646 14:66845728-66845750 ATTTTTCTAAAAAGATTGCTAGG + Intronic
1119988399 14:79166882-79166904 ATCTTTGTAAATAAAGTGCCTGG + Intronic
1120299404 14:82687220-82687242 ATATTTCTAAAATTAGTGCTTGG + Intergenic
1126336107 15:47587955-47587977 ATCTCTCTGAAAAGAGTGGCTGG + Intronic
1128483528 15:68060981-68061003 ATCTTTCTAAAACCAGATCCTGG - Intronic
1129191397 15:73939769-73939791 ATTTTTATAAAAAGAGTGACAGG + Intronic
1133403087 16:5502941-5502963 ATCTTGCTACAACGATTGCTTGG + Intergenic
1135253073 16:20917329-20917351 ATCTTTCTAAAAAGTCTGTCTGG + Intronic
1138313920 16:56052070-56052092 CTCTTTCTAAAAAGAGTGACCGG + Intergenic
1138371270 16:56528636-56528658 ATCTTTTTGAAACCAGTGCAGGG - Intergenic
1144579180 17:16448351-16448373 AGCTTCCTAGAACAAGTGCCTGG - Intronic
1149162881 17:53715928-53715950 ATCTTTCTAACAGGACTGTCAGG + Intergenic
1156896492 18:42252659-42252681 ATTTTTCAAAAACCAGTTCCTGG + Intergenic
1162239449 19:9337421-9337443 ATCTTTCTCAAGAGAGTGCAGGG + Intronic
1163485351 19:17582285-17582307 ATCTTTGTGACATGAGTGCCAGG - Exonic
1163636411 19:18438897-18438919 AACTTTCCAAAACAAGCGCCTGG + Intergenic
1165683938 19:37801871-37801893 ATCTTCCAAAAACCAGTCCCTGG - Intronic
925086522 2:1112239-1112261 ATCCTTCTCAAACGACTGCAAGG - Intronic
925086581 2:1112803-1112825 ATCCTTCTCAAACGACTGCAAGG - Intronic
932674837 2:73770628-73770650 ATCTTTCTAAAACATAAGCCTGG + Intronic
940904239 2:159154378-159154400 TTCTTTCTAAACTGGGTGCCTGG - Intronic
945039866 2:205734613-205734635 ATGTTTTTAAAACTAGTGTCAGG - Intronic
947871385 2:233440771-233440793 ACCTTTCTAAAACACGAGCCTGG - Intronic
1168756567 20:322524-322546 TTCTTTCTAAAACAACTCCCTGG - Intergenic
1170021527 20:11841612-11841634 ATATATATAAAAAGAGTGCCTGG - Intergenic
1172488105 20:35311801-35311823 ATATTTCTAAAAAGTGTCCCAGG + Intronic
1175166143 20:57046101-57046123 ATCTTGTTAAAACGAGTTGCTGG + Intergenic
1183442752 22:37832540-37832562 CTCTTTCTGATACGAGTGTCTGG + Intronic
1184484857 22:44770849-44770871 ATCTTTATAAAACGAATACAAGG - Intronic
949291397 3:2470746-2470768 ATATTCCTAAAACGAGAGGCAGG - Intronic
951072000 3:18339936-18339958 AACTTTATAAAACAAGTGGCAGG + Intronic
956378956 3:68645580-68645602 ATCTATCTTAAAATAGTGCCTGG - Intergenic
957987014 3:87585309-87585331 ATCTTTCTAAAATGAAAACCAGG + Intergenic
958588389 3:96120329-96120351 ATCTTTCTAGAACCAATGCATGG + Intergenic
959906301 3:111714458-111714480 ATGCTTCTTAAATGAGTGCCTGG - Intronic
963637312 3:147815286-147815308 GTCTTTTTAAAACAACTGCCTGG + Intergenic
974611963 4:64229205-64229227 GTCTTTCTAAAAGGAGTCTCTGG - Intergenic
983752712 4:171296882-171296904 ATCTGTCTAAAAAAAGTTCCAGG + Intergenic
986434287 5:7713106-7713128 AACATTCTAAAATGAGTACCAGG - Intronic
989687314 5:44105475-44105497 ATCTTTCAAAAACCAGCTCCTGG + Intergenic
989763854 5:45054431-45054453 ATCTTTCTAATACGTGAGTCTGG + Intergenic
990672555 5:58149400-58149422 ATCTTTCCAAAACCAGTGAAGGG - Intergenic
992714402 5:79495539-79495561 ATCTTTGTACTACCAGTGCCTGG + Intronic
993225045 5:85158854-85158876 ATCTTTGTAAAACTGGTGGCAGG - Intergenic
994461785 5:100074580-100074602 ATCTTTTTTGAACCAGTGCCTGG - Intergenic
994814190 5:104563432-104563454 ATCTTTCTTAAGCAAGGGCCTGG - Intergenic
996941140 5:129006384-129006406 AGCTTTAAAAAACGAGTGGCTGG - Intronic
998456156 5:142275113-142275135 GTCTTTTTAGAAAGAGTGCCTGG - Intergenic
1006029556 6:31169539-31169561 AGCTTTCTACAAGGGGTGCCAGG + Intronic
1011201405 6:84840582-84840604 ATCTTTCAAAAACCAGCTCCTGG + Intergenic
1011352765 6:86440580-86440602 ATGTTTTTAAAAGGAGTGACTGG - Intergenic
1011958878 6:93060873-93060895 ATCTTTCTAAAAAGCGATCCTGG + Intergenic
1016748461 6:147606674-147606696 ATATTTCTTAGACTAGTGCCTGG - Intronic
1016883153 6:148931129-148931151 ATCATTCTAAATCGAGTGGTTGG + Intronic
1017525921 6:155241267-155241289 ATCTTTCTCAAACCACTGACTGG - Intronic
1020290243 7:6717482-6717504 ATCTTTCTAAATCGAGGCCAGGG - Intergenic
1023745492 7:43319078-43319100 TTCTCTTTAAAACCAGTGCCTGG - Intronic
1030855915 7:114557297-114557319 TTATTTCTAAAACAAATGCCAGG - Intronic
1031176299 7:118356219-118356241 TTCTTTCTCAAAAGAGTGCTGGG - Intergenic
1032701442 7:134383487-134383509 ATCTTTCTAGAAAGAGTACAAGG + Intergenic
1032745332 7:134780643-134780665 CTCTTTCTAAAAGGAATTCCAGG - Intronic
1038477035 8:27875758-27875780 ATCTTTCTAAAACGAGTGCCTGG - Intronic
1043600115 8:81927485-81927507 AGCATTCTAAAAAGAGTGTCTGG - Intergenic
1045917977 8:107496107-107496129 ATCTTTTTAAAGGGATTGCCCGG + Intronic
1046855042 8:119021734-119021756 ATCTTTTTACTACGAGGGCCAGG - Intronic
1048256947 8:132912290-132912312 ATCTTTCTCCAAAGAGAGCCTGG + Intronic
1048408233 8:134144375-134144397 ATCTTTCTAAAAAGATTGTCTGG - Intergenic
1053331930 9:37219567-37219589 ATAATTCTTAAAAGAGTGCCAGG - Intronic
1058675060 9:107393203-107393225 ATCTTTCTAAAACTACTTGCAGG + Intergenic
1059009411 9:110440464-110440486 ATCTGTCTAAGTCCAGTGCCTGG - Intronic
1061106717 9:128536401-128536423 AACTTTCTAAAACGCATGTCAGG + Exonic
1189025767 X:37392371-37392393 ATCATTAGAAAACTAGTGCCAGG + Intronic
1201628500 Y:16042038-16042060 ATCTTTCAAAAACCAGCTCCTGG + Intergenic