ID: 1038478121

View in Genome Browser
Species Human (GRCh38)
Location 8:27883216-27883238
Sequence GGGTCCCCAACATTTCCCCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 114
Summary {0: 1, 1: 0, 2: 2, 3: 9, 4: 102}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1038478121_1038478127 28 Left 1038478121 8:27883216-27883238 CCAAGGGGAAATGTTGGGGACCC 0: 1
1: 0
2: 2
3: 9
4: 102
Right 1038478127 8:27883267-27883289 CTTTGGATCATCACAAAGCCAGG No data
1038478121_1038478125 11 Left 1038478121 8:27883216-27883238 CCAAGGGGAAATGTTGGGGACCC 0: 1
1: 0
2: 2
3: 9
4: 102
Right 1038478125 8:27883250-27883272 GAGCAACTGAAAGAAGCCTTTGG No data
1038478121_1038478128 29 Left 1038478121 8:27883216-27883238 CCAAGGGGAAATGTTGGGGACCC 0: 1
1: 0
2: 2
3: 9
4: 102
Right 1038478128 8:27883268-27883290 TTTGGATCATCACAAAGCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1038478121 Original CRISPR GGGTCCCCAACATTTCCCCT TGG (reversed) Intronic
902403989 1:16173207-16173229 GCGTCCCCACCATTCCCACTGGG + Intergenic
905797596 1:40824247-40824269 GGGGCCCCTACCTTTCCCCAGGG - Exonic
907269441 1:53282241-53282263 AGGTCCCCAACGTTATCCCTAGG + Intronic
913226446 1:116704516-116704538 GGGTCACCAATATTTACCTTGGG - Intronic
916984643 1:170177656-170177678 GGCTCCTCAACATTTTCACTTGG - Intergenic
918097794 1:181349071-181349093 GGGTCCCCAAGAGCTCCCCAAGG - Intergenic
919885998 1:201935362-201935384 GTCAACCCAACATTTCCCCTTGG + Intronic
920301105 1:204989591-204989613 GGGTCCCCAGCCTTTCCCAGAGG - Intronic
920936240 1:210437710-210437732 GGGTCACAAATATCTCCCCTGGG + Intronic
1069617060 10:69813156-69813178 AGGTCCCCAACATTCACCCCAGG + Intronic
1073469979 10:103716303-103716325 GGGCCCCCAACACTCCCCATGGG - Intronic
1076443472 10:130496106-130496128 CTGGCCCCAACATTTCCCCATGG + Intergenic
1077141754 11:1027874-1027896 GGGTCCCAAACCTATGCCCTTGG + Intronic
1085202037 11:74707711-74707733 GGCTCCCCAACACTTCCCTCAGG + Intronic
1096631130 12:52927376-52927398 GGCTCCCCACCCTTTCCCCAGGG - Intronic
1098316550 12:69199279-69199301 TGGTCCACAACAATTCTCCTAGG - Intergenic
1101916502 12:108900241-108900263 GGGTCCCCACCATTCCACCCCGG + Intronic
1104385014 12:128342989-128343011 GGATCCCCAAGATGTCCCCAGGG + Intronic
1112023784 13:95394260-95394282 GGGTCCACAACTCTCCCCCTGGG - Intergenic
1113021815 13:105895774-105895796 GGATTCCCATCTTTTCCCCTGGG + Intergenic
1115952777 14:38739918-38739940 GGCTCCCCCACATCTCCTCTTGG - Intergenic
1117060763 14:51960730-51960752 GGGTCCACAACATTTAACCTGGG + Intronic
1120889194 14:89476691-89476713 GGGTCCGCCACATTTCCACCAGG + Intronic
1121219437 14:92274786-92274808 GAGTCCCCCACTTTGCCCCTGGG + Intergenic
1122321864 14:100860249-100860271 GGGCTCTAAACATTTCCCCTCGG - Intergenic
1122796910 14:104210658-104210680 GGGTCCCCACCACTGCCCCTGGG - Intergenic
1135864685 16:26090496-26090518 GGGTGCACAAAATTTCCCATGGG + Intronic
1138212730 16:55176554-55176576 GGGTCCCCAGCATGTACTCTGGG - Intergenic
1138556502 16:57774005-57774027 GGGCCCCCAGCCTTTCACCTGGG - Intronic
1141574615 16:84955858-84955880 GGGTCCCCAACGGTACCCCCAGG + Intergenic
1141701398 16:85643822-85643844 TTGGCCCCAACTTTTCCCCTGGG + Intronic
1142264498 16:89057543-89057565 GGGGCTCCCACATTTCACCTGGG - Intergenic
1142264526 16:89057633-89057655 GGGGCTCCCACATTTCACCTGGG - Intergenic
1143038681 17:4016418-4016440 TGGTCCCCAGCATGTCCTCTCGG + Exonic
1147266438 17:39237496-39237518 GGGTGCCCCTCATTGCCCCTGGG + Intergenic
1149185640 17:53993914-53993936 AGATACCCAACATTTCCCCATGG + Intergenic
1151829134 17:76539250-76539272 GGCTGCCCAACAGGTCCCCTTGG + Intronic
1161327752 19:3671623-3671645 GGGAGCCCCACATTTTCCCTGGG - Intronic
1164492994 19:28731316-28731338 GGGCCGCCACCATCTCCCCTAGG + Intergenic
1164566783 19:29331422-29331444 TGATGCCCCACATTTCCCCTGGG + Intergenic
1165490837 19:36121763-36121785 GTGCCCCCAACATTTCCTCCCGG - Intronic
1167159714 19:47759311-47759333 ACGTCGCAAACATTTCCCCTAGG + Intergenic
930282173 2:49382753-49382775 AGGACCCCCACATTTCCCATAGG + Intergenic
931198714 2:60076879-60076901 GGGTTCCCACCATTGCCTCTTGG + Intergenic
932676411 2:73785451-73785473 TGGTCCCCTACTTTTCCCCTTGG + Intronic
932676997 2:73790352-73790374 TGGTCCCCTACTTTTCCCCTTGG + Intronic
932677582 2:73795249-73795271 TGGTCCCCTACTTTTCCCCTTGG + Intronic
932678168 2:73800147-73800169 TGGTCCCCTACTTTTCCCCTTGG + Intronic
932678754 2:73805047-73805069 TGGTCCCCTACTTTTCCCCTTGG + Intronic
932679330 2:73809934-73809956 GGGTCCCCTACTTTTCCCCTTGG + Intronic
938643364 2:133306087-133306109 GGATCCACAAAATTCCCCCTAGG - Intronic
946022326 2:216649559-216649581 GGGTCCCAAACATTTCTCCTTGG - Intronic
948770730 2:240250224-240250246 GGGACCCCAACACCTGCCCTGGG + Intergenic
948868685 2:240787637-240787659 GAGTCCCCAGCCATTCCCCTGGG - Intronic
1170686837 20:18576850-18576872 GGGTCCCCAAGACTACCCCCAGG - Intronic
1170828794 20:19821466-19821488 GGGGCCCCATCATTCCCCATAGG + Intergenic
1170952583 20:20950304-20950326 GTGTCCCCAACATTACCACAGGG - Intergenic
1171190937 20:23159009-23159031 GGGTGTCCAACATTTGCCATTGG + Intergenic
1175924197 20:62463972-62463994 GGGTCACTAACAATTCTCCTGGG + Exonic
1175975366 20:62708149-62708171 GAGCCCCCACCATTTCCACTGGG + Intergenic
1176050901 20:63119318-63119340 GGGTCCCCATCATTGCCTCCGGG + Intergenic
1176091943 20:63322106-63322128 GGCTCCCCAAAACTTACCCTGGG - Exonic
1176386210 21:6139715-6139737 CGGTCACCAACACTCCCCCTGGG - Intergenic
1177018788 21:15826222-15826244 CGGTCCCAAACGATTCCCCTTGG + Exonic
1177996173 21:28101877-28101899 GGGTCACAAAAGTTTCCCCTAGG - Intergenic
1178765894 21:35450688-35450710 CAGACCCCCACATTTCCCCTTGG + Intronic
1179737263 21:43398537-43398559 CGGTCACCAACACTCCCCCTGGG + Intergenic
1181892643 22:26077349-26077371 GGGTCGCCAACATCCTCCCTGGG + Intergenic
1183015681 22:34984516-34984538 GGTTCCTCAACATTCCCTCTGGG - Intergenic
1183061292 22:35337894-35337916 GGGTCCCCAACACCTGCCCTGGG + Intronic
1183790112 22:40060563-40060585 GGGTCCCCAAGACTATCCCTAGG + Intronic
1184590261 22:45477349-45477371 TGGCCCCCAACATTGTCCCTTGG + Intergenic
1185103993 22:48857129-48857151 GGGTCCCAAAAATGTCCCCAAGG + Intergenic
956579783 3:70797286-70797308 GGCTCCCCAACACTACCACTAGG - Intergenic
956647238 3:71468354-71468376 AGGACCCCAACATTTCTCCTTGG + Intronic
959012847 3:101098525-101098547 TGGTCCCCACCATTACCCATTGG + Intergenic
965506955 3:169526921-169526943 GGATCACCAACATTTCCTTTAGG - Intronic
975203916 4:71623122-71623144 GTGTTCCCAACATTCCCCCAAGG + Intergenic
981239856 4:142463969-142463991 GGGTCCCCAAGACTTCCTTTAGG - Intronic
986731268 5:10636643-10636665 GGGTACCCAGCACCTCCCCTGGG + Intronic
991368425 5:65893112-65893134 TGGTCCTCACCATTTCCCCAAGG - Intergenic
999231611 5:150065270-150065292 GGGTCCCCAAAGATTCCACTGGG - Intronic
1006024429 6:31138225-31138247 GGCTCCCCAACATTGCCTCAGGG - Exonic
1008686151 6:53928383-53928405 GGGTCCCCAACCTGTACCCCAGG + Intergenic
1012817193 6:104039188-104039210 GGTTCCCCATTCTTTCCCCTTGG + Intergenic
1013679982 6:112514410-112514432 GGCTCCTCAACATCTCCACTTGG - Intergenic
1018594236 6:165461086-165461108 AGAGCTCCAACATTTCCCCTTGG + Intronic
1024294808 7:47833461-47833483 AGGCCACCAACATTTCCCCAGGG - Intronic
1026362323 7:69614091-69614113 GGCTCCTCCTCATTTCCCCTCGG + Intronic
1026867636 7:73833288-73833310 GGGTCCCCAACCCTTCACCGGGG - Intergenic
1032639324 7:133748484-133748506 GGGTCCCCAAAATTACTCCCAGG + Intronic
1032879910 7:136077915-136077937 TGCACCACAACATTTCCCCTGGG + Intergenic
1035811734 8:2497364-2497386 GTGTGCCCAACATTTCCACGTGG - Intergenic
1038478121 8:27883216-27883238 GGGTCCCCAACATTTCCCCTTGG - Intronic
1038937468 8:32268088-32268110 GGTTCCCCAATATGGCCCCTTGG - Intronic
1039133582 8:34295144-34295166 GTGTTTCTAACATTTCCCCTGGG + Intergenic
1039653138 8:39365994-39366016 GGATCCCCAGTATTACCCCTTGG + Intergenic
1039986031 8:42448690-42448712 GTCTCCCCACCACTTCCCCTGGG - Intronic
1041868102 8:62599804-62599826 GTGTCCCTACCACTTCCCCTAGG + Intronic
1042326003 8:67528483-67528505 GGGGGGCCATCATTTCCCCTAGG + Intronic
1045060147 8:98403831-98403853 GGTGCCCCACCATATCCCCTTGG - Intronic
1046511115 8:115204021-115204043 GGGTTCCCAACCTTTCAGCTGGG - Intergenic
1053426311 9:38012411-38012433 GGGTCCTCACCATTACCCTTTGG - Intronic
1057211725 9:93204271-93204293 GGGTGCTCAACATTTCTGCTGGG + Intronic
1060840533 9:126789756-126789778 GGGTTCCCAGCATTTAGCCTAGG + Intergenic
1061588498 9:131583571-131583593 GGGTCCCTGACATGACCCCTGGG + Intronic
1061889185 9:133608838-133608860 GGGTCCCCCACCTCTCCCTTAGG + Intergenic
1062085374 9:134645443-134645465 GAGTCCCCAACACTTCCCGAGGG + Intronic
1185446042 X:258446-258468 GAGCCTCCACCATTTCCCCTAGG - Intergenic
1186303563 X:8228037-8228059 GGGTCCATAAGAGTTCCCCTTGG + Intergenic
1189898612 X:45682569-45682591 GGGCCCCCATAAGTTCCCCTTGG - Intergenic
1190029786 X:46960758-46960780 GGGTTCCCAAGATCACCCCTAGG - Intronic
1197899514 X:131354957-131354979 TGCTCCCCAACATTTACCCCAGG - Intronic
1200065899 X:153503913-153503935 GCGCCCCCAACACTGCCCCTGGG - Intronic