ID: 1038478780

View in Genome Browser
Species Human (GRCh38)
Location 8:27887171-27887193
Sequence AGGTGCCTCGCAGTCATTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 75
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 70}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1038478780_1038478786 15 Left 1038478780 8:27887171-27887193 CCTTCAATGACTGCGAGGCACCT 0: 1
1: 0
2: 0
3: 4
4: 70
Right 1038478786 8:27887209-27887231 CATCATACCACATTGAGCCCTGG No data
1038478780_1038478781 -8 Left 1038478780 8:27887171-27887193 CCTTCAATGACTGCGAGGCACCT 0: 1
1: 0
2: 0
3: 4
4: 70
Right 1038478781 8:27887186-27887208 AGGCACCTTCACCTCCTCCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1038478780 Original CRISPR AGGTGCCTCGCAGTCATTGA AGG (reversed) Intronic
900149875 1:1173699-1173721 AGCTGCCTCCCAGTCACTGCTGG - Intergenic
902219954 1:14958530-14958552 AGGAGCCTCACAGCCAATGAGGG + Intronic
902819923 1:18937599-18937621 AGGGGCTTTGCAGTCATGGAAGG - Intronic
902870415 1:19310887-19310909 GGGTGCCTGGCACTCAGTGAGGG - Intronic
912455385 1:109793260-109793282 GGGTGCCACGCAGTGACTGAGGG + Intergenic
1063190680 10:3691551-3691573 CTGTGCCTGGCAGTCATAGAAGG + Intergenic
1065918970 10:30374397-30374419 AGGTACTTTGCAGTCATTGCTGG - Intronic
1069846570 10:71376268-71376290 AGGTGCCTGGCAGCTACTGAGGG - Intergenic
1076343072 10:129763038-129763060 AGGGGCCTTTCAGTCAATGATGG - Intronic
1088448405 11:109956181-109956203 AGGCGTCATGCAGTCATTGATGG - Intergenic
1089330353 11:117685075-117685097 AGGTGCCTCGATGTCACGGAAGG - Intronic
1102953221 12:117043879-117043901 AGCTGCCTCCAAGTCCTTGAGGG + Intronic
1103393760 12:120592278-120592300 ACGTGGCTGGCAGTCATTGTTGG + Intergenic
1112007031 13:95262530-95262552 AGGTGTCTTGCAGTCCTTCACGG + Intronic
1120003740 14:79333295-79333317 AGGAGCCTTGCAGTCACTGAAGG - Intronic
1120243020 14:81972220-81972242 AGGTGCTACCCAGTAATTGAGGG - Intergenic
1121717927 14:96089490-96089512 AGGTGCCACCCAGTCACAGAAGG - Exonic
1128152942 15:65374936-65374958 AGGTGCCTGGCAGTGATTCGTGG - Intronic
1128802338 15:70504786-70504808 AGGTTCCTGGCAGTCATCAAGGG + Intergenic
1131345446 15:91643600-91643622 AGGTGCCTCTCAGTCCTTCTTGG - Intergenic
1132024522 15:98393509-98393531 TGGTGTCTCTCAGTCATTGCAGG - Intergenic
1136299153 16:29321536-29321558 AGTTGCCTCTCAGGCATTGCTGG + Intergenic
1142033586 16:87850479-87850501 TGGTGACTCGCAGTCACCGATGG - Intronic
1143559934 17:7687546-7687568 AGGAGCCTCGCAGGGGTTGATGG - Exonic
1144792746 17:17870369-17870391 AGGGGCCTGGCAGGAATTGACGG - Intronic
1145978908 17:28999932-28999954 AGGTGCTTCTCAGTCATTAGTGG - Intronic
1148123179 17:45224065-45224087 AGGTGCCTAGCAGAAATTTAGGG + Intronic
1148675845 17:49444437-49444459 AGGTGCCTCGGGGTTGTTGAAGG + Intronic
1160092045 18:75836636-75836658 AGCTGCCTGGCAATCATTAAAGG + Intergenic
1161761608 19:6177184-6177206 AGGTGCCTCACCCTCATAGAAGG - Intronic
1162297898 19:9826133-9826155 AGTTACCTCGCAGGCATTTAAGG + Intronic
926037170 2:9645070-9645092 AGGGGCCTCCCTGTCATTGCTGG + Intergenic
926243544 2:11105542-11105564 AGGTGCCTCAGAGACAGTGAGGG + Intergenic
934503484 2:94875640-94875662 AGGTGCCTCTTTGTCCTTGATGG - Exonic
937276197 2:120685635-120685657 AGGTGCTTGGCAGATATTGATGG + Intergenic
938149660 2:128871233-128871255 AGGTGCCTCTCATTTAATGAAGG + Intergenic
945476706 2:210291483-210291505 AGTTGCCTAGCAGACAGTGATGG - Intronic
946900123 2:224364261-224364283 AGGTCCCTGGCACTCAGTGAGGG - Intergenic
948316815 2:237033693-237033715 AGGAGTCTCGCAGTCATTGTAGG + Intergenic
1168897054 20:1330992-1331014 AGGTGGCTGGAAGTCAGTGATGG - Intronic
1170421715 20:16199967-16199989 CGGTGCCTCGCAGTTAGGGAAGG - Intergenic
1173783726 20:45777077-45777099 ACCTGCCTCGGAGACATTGAGGG - Exonic
1175077610 20:56389370-56389392 AGGTGCCTGGCAGACATTTTTGG - Intronic
1176056974 20:63154235-63154257 AAGAGCTTCGAAGTCATTGAGGG - Intergenic
949305404 3:2634975-2634997 ATGTGCCACTCAGTTATTGAAGG + Intronic
955228220 3:57078547-57078569 GGGTGCCTCGCAGCCAGAGACGG - Intronic
968191400 3:196670427-196670449 TGGGGCCTCCCAGTCATTGAGGG + Intronic
968481591 4:835396-835418 AGATGCCTTGCAGGCACTGAGGG + Intergenic
976584066 4:86775507-86775529 AGGTCCGTCGCAGCCATTGAGGG + Exonic
987336449 5:16901715-16901737 AGGTGCCTGGTACTCATTGTAGG - Intronic
988641175 5:33041925-33041947 AGGTGCCCCACATGCATTGAGGG + Intergenic
993340674 5:86721433-86721455 AGGTGCCAGGCAGTGAATGAGGG + Intergenic
994711193 5:103266594-103266616 ATGTGTCTCGAAGTCTTTGAAGG + Intronic
996941543 5:129011734-129011756 AGGAGCTTCCCAGTCATTTAAGG + Intronic
998997071 5:147877338-147877360 AGGTGCATGGCAGGCATTCATGG + Intronic
1001593790 5:172884917-172884939 AGGTGCCTCACTGTCAGGGAAGG - Intronic
1004342253 6:14817949-14817971 AGGGGCCTTTCAGTCAATGAGGG + Intergenic
1010724167 6:79313976-79313998 ATGTGCCTCTCAGTCTTAGAAGG + Intergenic
1018479660 6:164177122-164177144 AGGTGTCTCTGAGTCATTCAAGG - Intergenic
1020514901 7:9106293-9106315 AGGTGACTCCCACCCATTGAGGG + Intergenic
1028635338 7:92982746-92982768 AGAAGCCTAGCAGCCATTGATGG - Intergenic
1032794674 7:135268275-135268297 AGGTGCCTGACAGTCAGTGGTGG + Intergenic
1032984812 7:137326165-137326187 AAGGGCCTCCCAGGCATTGAGGG + Intronic
1038478780 8:27887171-27887193 AGGTGCCTCGCAGTCATTGAAGG - Intronic
1042895876 8:73667311-73667333 AGGTGATTGGGAGTCATTGAAGG - Intronic
1044503173 8:92986061-92986083 TGGTGCCTCCCTGTGATTGAAGG - Intronic
1045763685 8:105642033-105642055 AGGTGACTCACTGTCATTCAAGG + Intronic
1047179697 8:122575360-122575382 AGGTGACTAGCAGTGAGTGAAGG + Intergenic
1048859626 8:138714485-138714507 AGGAGCCTGGCAGTCATTCTGGG - Intronic
1057094456 9:92293307-92293329 AAGTATCTCGCAGCCATTGAAGG + Intronic
1060744912 9:126124893-126124915 AAGTGGATGGCAGTCATTGAGGG + Intergenic
1203564375 Un_KI270744v1:79526-79548 AGGTGCCTCCTTGTCCTTGATGG - Intergenic
1190362484 X:49662295-49662317 TGGTGCTTTGCAGACATTGAAGG + Intergenic
1194777894 X:97988183-97988205 AGCTGACTCACAGTCACTGATGG + Intergenic
1201159063 Y:11154966-11154988 AGGTGCCTCCTTGTCCTTGATGG + Intergenic