ID: 1038479249

View in Genome Browser
Species Human (GRCh38)
Location 8:27890516-27890538
Sequence TAGATGGCGTGGAGGGCAAT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1038479244_1038479249 -10 Left 1038479244 8:27890503-27890525 CCTAAATGCTGAATAGATGGCGT 0: 1
1: 0
2: 0
3: 5
4: 64
Right 1038479249 8:27890516-27890538 TAGATGGCGTGGAGGGCAATGGG No data
1038479237_1038479249 27 Left 1038479237 8:27890466-27890488 CCTTAACACTTAACATGACACGT 0: 1
1: 0
2: 0
3: 7
4: 88
Right 1038479249 8:27890516-27890538 TAGATGGCGTGGAGGGCAATGGG No data
1038479235_1038479249 29 Left 1038479235 8:27890464-27890486 CCCCTTAACACTTAACATGACAC 0: 1
1: 0
2: 0
3: 11
4: 115
Right 1038479249 8:27890516-27890538 TAGATGGCGTGGAGGGCAATGGG No data
1038479236_1038479249 28 Left 1038479236 8:27890465-27890487 CCCTTAACACTTAACATGACACG 0: 1
1: 0
2: 0
3: 4
4: 65
Right 1038479249 8:27890516-27890538 TAGATGGCGTGGAGGGCAATGGG No data
1038479243_1038479249 -9 Left 1038479243 8:27890502-27890524 CCCTAAATGCTGAATAGATGGCG 0: 1
1: 0
2: 0
3: 3
4: 68
Right 1038479249 8:27890516-27890538 TAGATGGCGTGGAGGGCAATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1038479249 Original CRISPR TAGATGGCGTGGAGGGCAAT GGG Intronic
No off target data available for this crispr