ID: 1038480678

View in Genome Browser
Species Human (GRCh38)
Location 8:27899718-27899740
Sequence GTACAGCATGGCAAGGGTTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 190
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 174}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1038480678_1038480686 19 Left 1038480678 8:27899718-27899740 CCCAAACCCTTGCCATGCTGTAC 0: 1
1: 0
2: 0
3: 15
4: 174
Right 1038480686 8:27899760-27899782 ACATTATGCTGTTTCAAGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1038480678 Original CRISPR GTACAGCATGGCAAGGGTTT GGG (reversed) Intronic
905490307 1:38338251-38338273 GCACAGCATTGCAAGGGCTCTGG - Intergenic
906946498 1:50298848-50298870 GAACAGCATGGAAAGAGGTTTGG - Intergenic
909642536 1:77884531-77884553 GTACAGCATTGTAAAGATTTTGG - Intergenic
910713686 1:90207764-90207786 GGTCAGCATCGCAGGGGTTTAGG + Intergenic
912255348 1:108052729-108052751 GTAGAACATGGCAAGGGGTTTGG + Intergenic
913659929 1:120997806-120997828 GTAGACCATGGCAAGGAGTTTGG - Intergenic
914166548 1:145180179-145180201 GTAGACCATGGCAAGGAGTTTGG + Intergenic
914649910 1:149689596-149689618 GTAGACCATGGCAAGGAGTTTGG - Intergenic
915125794 1:153663192-153663214 GTACAGCATGCTTTGGGTTTAGG - Intronic
917560062 1:176141613-176141635 GTATGGGATGACAAGGGTTTTGG - Intronic
919032322 1:192258707-192258729 GGCCATCATGGCAAGGGTTAAGG - Intergenic
919930341 1:202217167-202217189 CAACAGCATGCCAAGGGTGTGGG - Intronic
921247815 1:213263920-213263942 TTTCAGCATGGCAAGGATGTGGG + Intronic
924423141 1:243928006-243928028 GCAGAGCATGGCAGGGGTTGAGG + Intergenic
1067509326 10:46882348-46882370 ATTCAGCATGGCAGGGGCTTAGG + Intergenic
1067652927 10:48169507-48169529 ATTCAGCATGGCAGGGGCTTAGG - Intronic
1067815883 10:49476635-49476657 GTAGAGCATGGCATGGGTCATGG - Intronic
1068940766 10:62678621-62678643 TTGCAGCATGGCAAAGGATTTGG - Intergenic
1069749570 10:70736660-70736682 GAACTGCATGGCAAGGGAATGGG - Exonic
1072797219 10:98365264-98365286 TGAAAGCATGGAAAGGGTTTGGG - Intergenic
1075875658 10:125803770-125803792 GTACAGCATGGCAGGGGCAGTGG - Intronic
1076797050 10:132803423-132803445 GTCCAGCCTGGCTAGGGTTGGGG - Intergenic
1077112791 11:869298-869320 GTCCAGCACGGCAAGGGTGCAGG - Exonic
1078871693 11:15351367-15351389 ATAGGGCATGGCAAGGATTTTGG + Intergenic
1079142704 11:17823399-17823421 GTAGAGCATGGAAAGGGGTTGGG - Intronic
1079674145 11:23203345-23203367 TTGCAGCATGGCAAGAGTTGGGG - Intergenic
1080174934 11:29351646-29351668 TTATAGCATGGCAGGGGATTAGG - Intergenic
1081570084 11:44285296-44285318 GAACAGCATGGAAAGGGGTACGG - Intronic
1083916159 11:65744974-65744996 TCACAACATGGCAAGGGTTGGGG - Intergenic
1084142441 11:67241604-67241626 GTACAGGATGGTAACTGTTTCGG - Intronic
1085996701 11:81925438-81925460 GTACAGCATGGAAAGGGGAAGGG - Intergenic
1089413714 11:118268855-118268877 GTACACCATTCAAAGGGTTTTGG - Intergenic
1091164630 11:133464242-133464264 TTACAAAATGGCAAGGGCTTTGG - Intronic
1092365314 12:7872539-7872561 GTCCAGCAAGGCAAGGGCTGGGG + Intronic
1093317158 12:17666255-17666277 CTGCAGCATGGCGAGGGTTGGGG + Intergenic
1094552388 12:31465102-31465124 GGACAGCATGGCAGGGGCTGAGG - Intronic
1094766506 12:33601530-33601552 GTAGGCCATGGCAAGGATTTTGG + Intergenic
1095639628 12:44472909-44472931 AGACAGCATGCCAAGGGTCTTGG + Intergenic
1096862909 12:54542724-54542746 TTCCACTATGGCAAGGGTTTAGG - Exonic
1097103222 12:56604144-56604166 GTGAAGCATAGCCAGGGTTTTGG - Intronic
1100221608 12:92510279-92510301 GTATGCCATGTCAAGGGTTTGGG - Intergenic
1101923421 12:108951742-108951764 GTTCAACATGGTAAGGGCTTTGG + Intronic
1102108215 12:110344004-110344026 GCATAGAATGGAAAGGGTTTGGG + Intronic
1102433030 12:112898365-112898387 GTAGAGAATGTCAGGGGTTTGGG - Exonic
1103146722 12:118601308-118601330 GTATAGCATGGCCAGAGTGTTGG - Intergenic
1104606291 12:130191455-130191477 GGACAGCATGGCATGGGTGCAGG - Intergenic
1105540643 13:21313319-21313341 GTACAGAATGGGTAGGGTTCTGG + Intergenic
1106451718 13:29888399-29888421 GCAGGGCAGGGCAAGGGTTTAGG - Intergenic
1106564299 13:30871554-30871576 CTGCAGCCTGGGAAGGGTTTGGG - Intergenic
1107335455 13:39349915-39349937 GTAAAGCAAGGGATGGGTTTGGG + Intronic
1107435382 13:40376729-40376751 GTGGAGGATGGCATGGGTTTGGG - Intergenic
1107469116 13:40675642-40675664 GCACATCATAGCAAGAGTTTAGG + Intergenic
1112040115 13:95538753-95538775 GTACAGCAGGACAACGGTGTTGG - Intronic
1112430102 13:99343443-99343465 CTCCAGCAGGGCAGGGGTTTGGG - Intronic
1113619464 13:111703078-111703100 GGAGAGCAGGGCAAGGGTTTGGG + Intergenic
1113624993 13:111788339-111788361 GGAGAGCAGGGCAAGGGTTTGGG + Intergenic
1118432032 14:65728477-65728499 GAACAGCACGGGAAAGGTTTGGG + Intronic
1119085719 14:71737145-71737167 GTACAGTGTGGCAAGGCTGTGGG - Intronic
1120003022 14:79325080-79325102 ACAAAGCATGGCGAGGGTTTGGG - Intronic
1126679281 15:51188051-51188073 GAACAGAATGGCAAGGGCTTCGG - Intergenic
1127378576 15:58407887-58407909 GTACATCTGGGCAAGGGTCTCGG - Intronic
1127668143 15:61169218-61169240 GCCCAGAATGGCAAGGGTTAAGG - Intronic
1128258433 15:66214967-66214989 GTCCTGCATGGCAAGGGCTGAGG + Intronic
1129100060 15:73253152-73253174 GTACAGCCTGGCTTGGGTGTAGG + Intronic
1129300833 15:74624528-74624550 GGACAGCCTGGCCAGGGTTGGGG + Intronic
1129375753 15:75130074-75130096 GTCCACCATGGCAAGGATGTGGG + Intergenic
1130891678 15:88138714-88138736 ATATAGCATGGCAAGGGACTGGG - Intronic
1132307328 15:100825874-100825896 GGACACCAGGGCAAGGATTTTGG - Intergenic
1136459145 16:30398970-30398992 GCAGAGTGTGGCAAGGGTTTTGG + Exonic
1137468080 16:48729469-48729491 GTCAATCATTGCAAGGGTTTTGG + Intergenic
1138220051 16:55242648-55242670 GTACAGCAAGGCAAGGACCTGGG + Intergenic
1139487097 16:67264090-67264112 GGAAAGGATGGCAAGGGTTGGGG + Intronic
1141056472 16:80819880-80819902 GTACAGTATGGAAAGGGTGAGGG + Intergenic
1144493644 17:15734160-15734182 GTCCAGCATGGCAAAGGGTAGGG - Intronic
1144906621 17:18642492-18642514 GTCCAGCATGGCAAAGGGTAGGG + Intronic
1147321972 17:39652031-39652053 GCACAGGATGGTAAGGGATTGGG + Intronic
1155486697 18:26351351-26351373 GTAGAGGATGGAAAGGGTCTGGG + Intronic
1155500495 18:26482627-26482649 GTGCAGCATGGGAAGGGTGGGGG - Intronic
1156389562 18:36637824-36637846 GTACAGCATGGCAAACAATTGGG + Intronic
1156681527 18:39595023-39595045 GTAGAATATGGCAAGGGTTATGG - Intergenic
1161174637 19:2833882-2833904 CTACTGCATGGCATGGATTTGGG + Exonic
1164795692 19:31025975-31025997 ATAGAGCATGGGAAGGGTTGGGG - Intergenic
1165229456 19:34377826-34377848 GTTCAGCTGGGCCAGGGTTTTGG - Exonic
928936364 2:36683008-36683030 GTACAGCATGCCAAGGAGTTTGG + Intergenic
933501518 2:83117953-83117975 TTTCAACAAGGCAAGGGTTTTGG - Intergenic
936597275 2:113860644-113860666 GAACAGCATGGCACTGGTTTAGG + Intergenic
937264034 2:120604935-120604957 GGACAGCAGGGCCAGGGTCTGGG + Intergenic
939551636 2:143623107-143623129 GTGCAACATGGAAAAGGTTTTGG - Intronic
940192954 2:151061917-151061939 CCACAGTATGGCAAGGGTTGGGG - Intergenic
944294021 2:198041848-198041870 GTTGAGCATGGCATGTGTTTTGG + Intronic
947583003 2:231333231-231333253 GTAGGTCATGGCAAGGGTTTGGG + Intronic
1170354414 20:15476738-15476760 GTAAAGCATTGCTATGGTTTTGG + Intronic
1170358958 20:15523574-15523596 GCACAGCCTGGGATGGGTTTTGG - Intronic
1170761252 20:19253462-19253484 ATACAACATGGAAAGGGTTGGGG - Intronic
1173031802 20:39367896-39367918 GTAGACCATGGAAAGGATTTTGG - Intergenic
1173492795 20:43496996-43497018 GCACAGTATGGCAAGGGATGGGG - Intergenic
1174043217 20:47714677-47714699 GTAGGGCATGGCAAGGACTTTGG - Intronic
1175634468 20:60569113-60569135 GAAGATCATGGCAAGGATTTAGG + Intergenic
1177802643 21:25842928-25842950 GTACAGAAGGGCTTGGGTTTGGG + Intergenic
1180023285 21:45142911-45142933 GTGCAGCATGGCCATGGTGTTGG - Intronic
1181560668 22:23697762-23697784 GTGCAGCATGGGAAGGGGTGGGG + Intronic
1182046707 22:27280124-27280146 GTACAAAATGGCTGGGGTTTAGG + Intergenic
1183252998 22:36743667-36743689 GCACACCAGGGCAAGGATTTGGG + Intergenic
1183478389 22:38049534-38049556 GTGCAGCATGGGCAGGGTTGTGG + Intergenic
1184631196 22:45781300-45781322 GTACAGCTGGGCAGGGGTTGGGG - Intronic
950496460 3:13337035-13337057 GAAGAGCATGGCACAGGTTTGGG + Intronic
953389271 3:42525300-42525322 GCACAGCATGGCAGGAGCTTGGG - Intronic
954788642 3:53114189-53114211 CCACAGCATGGCAAGGGGTGAGG - Intronic
955474437 3:59321452-59321474 GGATAGCATGGCTAGGGTTGGGG + Intergenic
956938352 3:74129739-74129761 GTAGAGCATGGCAAATGTGTTGG + Intergenic
962071034 3:132034266-132034288 GGACAGCATGGCACGGGTGAGGG - Intronic
964728020 3:159835225-159835247 GAACAGAATGGAAGGGGTTTTGG + Intronic
974070364 4:57118014-57118036 TTACAGCAGGGCAAGTGATTTGG + Intergenic
975668206 4:76754622-76754644 GTGCATCATGGCAGGGGTGTAGG - Exonic
975890454 4:79021073-79021095 GTAATGCATGTTAAGGGTTTTGG + Intergenic
978126102 4:105136836-105136858 TTAAATCATGGTAAGGGTTTTGG - Intergenic
983995044 4:174171728-174171750 GTACAGGATGAAAAGAGTTTGGG + Intergenic
985535970 5:465951-465973 CTGCAGCACGGCAAGGGTTCAGG + Intronic
986981988 5:13458431-13458453 GTACAGCAGGACAAGGGTGATGG - Intergenic
990273751 5:54173781-54173803 GTAGACCATGGTAAGGGTTTGGG - Intronic
992136114 5:73747801-73747823 GTAAAGCATGGCATGGTTCTTGG + Intronic
993486813 5:88497046-88497068 CTACAGGATGGAAAGGGTGTTGG - Intergenic
996058526 5:119006872-119006894 ATACAGCATGGAAAGGGAGTGGG + Intergenic
998686875 5:144537061-144537083 GTCAAGGTTGGCAAGGGTTTGGG - Intergenic
1001034190 5:168285458-168285480 GTACAGGAAGCCATGGGTTTGGG + Intergenic
1002571046 5:180139538-180139560 TTACAGCATGGGAAGGGCTCAGG + Intronic
1016170488 6:141008635-141008657 GTAAACCATGACAAGGGTCTAGG - Intergenic
1016187388 6:141213387-141213409 GTAAAGAATGGCAAGGATTATGG - Intergenic
1019598668 7:1870341-1870363 GTTCAGCATGGCAGGTGTTACGG - Intronic
1019598784 7:1871054-1871076 GTTCAGCATGGCAGGTGTTACGG - Intronic
1023493585 7:40770097-40770119 GTTCAGCATGACAGGGGTTCAGG - Intronic
1023836568 7:44072172-44072194 GGACAGCATGGGAAGTGTTCTGG + Intergenic
1024476677 7:49819456-49819478 GCACAGCATGGCCCGTGTTTTGG - Intronic
1025292327 7:57741133-57741155 ATACAGCATGTCCAGGTTTTAGG + Intergenic
1035320519 7:158026441-158026463 GGACAGCATGGCGTGGATTTTGG + Intronic
1038480678 8:27899718-27899740 GTACAGCATGGCAAGGGTTTGGG - Intronic
1043741257 8:83814661-83814683 GCACAGCATTGCAAGGGTGGGGG + Intergenic
1045924621 8:107570228-107570250 GTACATCATTGCAAGGGTAATGG + Intergenic
1047517144 8:125564899-125564921 ATAAAGCAGGGAAAGGGTTTGGG + Intergenic
1048615854 8:136074940-136074962 GTACATCATGGTAAGGATTTTGG + Intergenic
1049259419 8:141630820-141630842 GAACAGCATGGGAAAGGTTCTGG + Intergenic
1049259471 8:141631067-141631089 GAACAGCATGGGAAAGGTTCTGG + Intergenic
1049259491 8:141631178-141631200 GAACAGCATGGGAAAGGTTCTGG + Intergenic
1049259495 8:141631200-141631222 GAACAGCATGGGAAAGGTTCTGG + Intergenic
1049259504 8:141631245-141631267 GTACAGCATGGGAAAGGTTCTGG + Intergenic
1049259513 8:141631290-141631312 GTACAGCATGGGAAAGGTTCTGG + Intergenic
1049259520 8:141631335-141631357 GTACAGCATGGGAAACGTTCTGG + Intergenic
1049259534 8:141631403-141631425 GAACAGCATGGGAAAGGTTCTGG + Intergenic
1049259569 8:141631583-141631605 GAACAGCATGGGAAAGGTTCTGG + Intergenic
1049259611 8:141631830-141631852 GAACAGCATGGGAAAGGTTCTGG + Intergenic
1049259663 8:141632081-141632103 GAACAGCATGGGAAAGGTCTCGG + Intergenic
1049259689 8:141632214-141632236 GAACAGCATGGGAAAGGTTCTGG + Intergenic
1049259699 8:141632259-141632281 GAACAGCATGGGAAAGGTTCTGG + Intergenic
1049259707 8:141632304-141632326 GTACAGCATCGGAAAGGTTCTGG + Intergenic
1049259716 8:141632349-141632371 GTACAGCATGGGAAAGGTTCTGG + Intergenic
1049259724 8:141632394-141632416 GTACAGCATGGGAAACGTTCTGG + Intergenic
1049259739 8:141632462-141632484 GAACAGCATGGGAAAGGTTCTGG + Intergenic
1049259759 8:141632575-141632597 GAACAGCATGGGAAAGGTTCTGG + Intergenic
1049259810 8:141632867-141632889 GAACAGCATGGGAAAGGTTCTGG + Intergenic
1049259832 8:141632978-141633000 GAACAGCATGGGAAAGGTTCTGG + Intergenic
1049259878 8:141633207-141633229 GAACAGCATGGGAAAGGTCTCGG + Intergenic
1049259904 8:141633340-141633362 GAACAGCATGGGAAAGGTTCTGG + Intergenic
1049259914 8:141633385-141633407 GAACAGCATGGGAAAGGTTCTGG + Intergenic
1049259922 8:141633430-141633452 GTACAGCATCGGAAAGGTTCTGG + Intergenic
1049259931 8:141633475-141633497 GTACAGCATGGGAAAGGTTCTGG + Intergenic
1049259939 8:141633520-141633542 GTACAGCATGGGAAACGTTCTGG + Intergenic
1049259954 8:141633588-141633610 GAACAGCATGGGAAAGGTTCTGG + Intergenic
1049259974 8:141633701-141633723 GAACAGCATGGGAAAGGTTCTGG + Intergenic
1049260025 8:141633993-141634015 GAACAGCATGGGAAAGGTTCTGG + Intergenic
1049260038 8:141634060-141634082 GAACAGCATGGGAAAGGTTCTGG + Intergenic
1049260044 8:141634104-141634126 GAACAGCATGGGAAAGGTTCTGG + Intergenic
1049260090 8:141634333-141634355 GAACAGCATGGGAAAGGTCTCGG + Intergenic
1049260116 8:141634466-141634488 GAACAGCATGGGAAAGGTTCTGG + Intergenic
1049260126 8:141634511-141634533 GAACAGCATGGGAAAGGTTCTGG + Intergenic
1049260134 8:141634556-141634578 GTACAGCATCGGAAAGGTTCTGG + Intergenic
1049260143 8:141634601-141634623 GTACAGCATGGGAAAGGTTCTGG + Intergenic
1049260151 8:141634646-141634668 GTACAGCATGGGAAACGTTCTGG + Intergenic
1049260166 8:141634714-141634736 GAACAGCATGGGAAAGGTTCTGG + Intergenic
1049260179 8:141634782-141634804 GAACAGCATGGGAAAGGTTCTGG + Intergenic
1049260201 8:141634895-141634917 GAACAGCATGGGAAAGGTTCTGG + Intergenic
1051370524 9:16355309-16355331 GGAAAGCATGGCTAGGGCTTGGG - Intergenic
1054756734 9:68966315-68966337 GTACAGCATGGAAAGGGAGGTGG + Intronic
1059231123 9:112722490-112722512 ATACATCATGGCATGGGGTTAGG - Intergenic
1061724022 9:132571631-132571653 GCACAGGGTGGAAAGGGTTTGGG - Intronic
1188801555 X:34537573-34537595 TTACAACATTGCAAAGGTTTTGG + Intergenic
1191046490 X:56143640-56143662 GTAAAGAATGGTAAGGGTTGGGG - Intergenic
1195027791 X:100895463-100895485 GTATAGCATGGTAAGGAGTTTGG + Intergenic
1197556872 X:127966545-127966567 GAACAGCATAGCAAGGGATATGG - Intergenic
1197705313 X:129630479-129630501 GTACAGAATGGGGAGGGATTTGG + Intergenic
1198178906 X:134184988-134185010 CTAGAGCATGGCAGGGGGTTGGG - Intergenic