ID: 1038485082

View in Genome Browser
Species Human (GRCh38)
Location 8:27929339-27929361
Sequence GGGAAGGCAGCCTATCTGGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 205
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 189}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1038485082_1038485093 16 Left 1038485082 8:27929339-27929361 CCAACCAGATAGGCTGCCTTCCC 0: 1
1: 0
2: 1
3: 14
4: 189
Right 1038485093 8:27929378-27929400 CCCTACAGTGCCAGCTGGGTAGG No data
1038485082_1038485090 11 Left 1038485082 8:27929339-27929361 CCAACCAGATAGGCTGCCTTCCC 0: 1
1: 0
2: 1
3: 14
4: 189
Right 1038485090 8:27929373-27929395 GGTGTCCCTACAGTGCCAGCTGG No data
1038485082_1038485084 -10 Left 1038485082 8:27929339-27929361 CCAACCAGATAGGCTGCCTTCCC 0: 1
1: 0
2: 1
3: 14
4: 189
Right 1038485084 8:27929352-27929374 CTGCCTTCCCCCAATACATCAGG No data
1038485082_1038485091 12 Left 1038485082 8:27929339-27929361 CCAACCAGATAGGCTGCCTTCCC 0: 1
1: 0
2: 1
3: 14
4: 189
Right 1038485091 8:27929374-27929396 GTGTCCCTACAGTGCCAGCTGGG No data
1038485082_1038485096 29 Left 1038485082 8:27929339-27929361 CCAACCAGATAGGCTGCCTTCCC 0: 1
1: 0
2: 1
3: 14
4: 189
Right 1038485096 8:27929391-27929413 GCTGGGTAGGTACATGTGTATGG No data
1038485082_1038485097 30 Left 1038485082 8:27929339-27929361 CCAACCAGATAGGCTGCCTTCCC 0: 1
1: 0
2: 1
3: 14
4: 189
Right 1038485097 8:27929392-27929414 CTGGGTAGGTACATGTGTATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1038485082 Original CRISPR GGGAAGGCAGCCTATCTGGT TGG (reversed) Intronic
900395691 1:2452387-2452409 TGGAGGGGGGCCTATCTGGTGGG + Intronic
900679491 1:3908835-3908857 GGGGAGCCAGCCTGTCTGGGTGG + Intergenic
901640823 1:10692256-10692278 TGGAAGGCAGGCCCTCTGGTCGG - Intronic
902278778 1:15359282-15359304 TGGAAGGCAGCCTCTTAGGTAGG + Intronic
904945828 1:34198021-34198043 GACAAAGCAGCCTCTCTGGTGGG + Intronic
906359552 1:45141556-45141578 TAGTAGGCAGTCTATCTGGTTGG - Intronic
907456898 1:54581855-54581877 GGGCAGGCAGCCAGTCTGGGAGG - Intronic
907923790 1:58937141-58937163 GGGAAGTCAGCCTAACTTGAGGG + Intergenic
908456433 1:64309002-64309024 GGGAAGGAAGCCTGTTTGGCTGG + Intergenic
909487418 1:76189197-76189219 GGCAAGGGTGCCTATCTGCTGGG + Intronic
913524214 1:119675763-119675785 GGGAAGGCTGACCATCTGATTGG - Intronic
913937307 1:125066362-125066384 GGGGAGGCAGCCTGACTGCTAGG + Intergenic
916100645 1:161390481-161390503 GAGAAGGCAGCCCATCTCCTGGG - Intergenic
918043558 1:180927701-180927723 AGGGAGGCAGCACATCTGGTAGG + Intronic
919081757 1:192875714-192875736 GGGAAGGAGGCTTATCTTGTGGG + Intergenic
923438490 1:233992874-233992896 GGGAGGGCAGCCTGTCTGAAAGG + Intronic
1063667276 10:8070655-8070677 GGGGAGGAAGCTTTTCTGGTTGG + Intronic
1064148235 10:12842182-12842204 GGGAAGGCAGGCTGCCTTGTAGG - Intergenic
1066071749 10:31822753-31822775 GGAAAGGCAGGCTAGATGGTAGG - Intronic
1067833052 10:49621322-49621344 GGGAAGGCTGGCCAGCTGGTAGG - Intronic
1069773340 10:70912998-70913020 GGGGAGGCAGCTTAGATGGTTGG - Intergenic
1071598596 10:86945146-86945168 GGGAAGGCAGGCAGGCTGGTGGG - Intronic
1073035245 10:100560301-100560323 GGGAAGACAGCCTGGCTGGAGGG - Intergenic
1074418401 10:113287094-113287116 GGGAGGGCTGCCTATCAGGTGGG + Intergenic
1074424266 10:113337434-113337456 GAGAAGGCAGGCTCTCTGATGGG + Intergenic
1075878175 10:125824840-125824862 GGAAAGGCAGCCTAGATGGCTGG + Intronic
1076357556 10:129864166-129864188 AGGAAGGCATCCTACCTGGCTGG + Intronic
1077319646 11:1935521-1935543 GGGAAGGCAGCCTGCCCGGGCGG + Intronic
1079380228 11:19931721-19931743 GGAAGGGCAGCCTCTCCGGTTGG + Intronic
1085395558 11:76205497-76205519 AGGAAGGAAGCCCACCTGGTGGG - Intronic
1091661069 12:2384085-2384107 AGGAAGGCAGCTTGTCTGGAGGG - Intronic
1091792561 12:3280247-3280269 GGGAAGGCAGCTGGTCTGGAAGG - Intronic
1093005642 12:14047944-14047966 GGGAATCTAGACTATCTGGTGGG + Intergenic
1093749521 12:22782135-22782157 GGGAAGCTAGGCTTTCTGGTTGG + Intergenic
1096916509 12:55039204-55039226 GGGAAGGCAGGGGAGCTGGTAGG - Intergenic
1100694311 12:97075035-97075057 GGGAAGGCAGCCTTCCTGGGAGG - Intergenic
1103168111 12:118788210-118788232 GAGAAGGCATCTTATCTGTTGGG + Intergenic
1103202919 12:119103502-119103524 GAGAGGGCAGCCTAGGTGGTGGG - Intronic
1103286100 12:119803053-119803075 GGGAAAGCAGTCTACCTGTTAGG - Intronic
1103809645 12:123603135-123603157 GGGAAGCCATCTTATCTGGGAGG + Intronic
1106360822 13:29029081-29029103 GGCAAGGCAGCACAGCTGGTCGG - Intronic
1110628492 13:77678738-77678760 GGGCAGGCAGCCTGCATGGTGGG + Intergenic
1116025046 14:39505084-39505106 GGGCTGACAGGCTATCTGGTGGG + Intergenic
1122792017 14:104187987-104188009 AGGAAGGCAGCCTCTCTCCTCGG + Intergenic
1122953134 14:105056769-105056791 GGGAAGAGAGCCTTCCTGGTGGG + Intronic
1124180126 15:27465375-27465397 GGGAAAGCAGCTGAGCTGGTAGG - Intronic
1126671373 15:51118419-51118441 GGGAAGTCAGCCAATTTCGTTGG - Intergenic
1129238733 15:74239473-74239495 GGCAAGGCTGCCTGTCTGTTTGG + Intronic
1132621183 16:868929-868951 GGGAGGGCATCCTACCTGGGCGG + Exonic
1132852972 16:2033123-2033145 GGGACGGAAGCCTAGCTGGGTGG + Intronic
1132958033 16:2606741-2606763 GCTAAAGCATCCTATCTGGTAGG + Intergenic
1132970507 16:2685989-2686011 GCTAAAGCATCCTATCTGGTAGG + Intronic
1135198703 16:20418152-20418174 AGGAAGGCAGCCAATGTGCTGGG + Exonic
1135648460 16:24185080-24185102 GAGAAGGCACCCTATCAGGGAGG - Intronic
1135994574 16:27238370-27238392 GGAAGTGCAGCTTATCTGGTTGG - Intronic
1136476703 16:30517967-30517989 ATGGAGGCAGACTATCTGGTGGG - Intronic
1136918942 16:34245793-34245815 GGCCAGCCACCCTATCTGGTAGG - Intergenic
1141888355 16:86909063-86909085 GGGCAGGGTTCCTATCTGGTTGG + Intergenic
1142119401 16:88378533-88378555 GGGCAGGAAGCCCATCTGGACGG - Intergenic
1142267257 16:89070434-89070456 GGGGAGAGAGCCTAGCTGGTGGG - Intergenic
1143393730 17:6575873-6575895 TGGAAGGCAGCCTTAGTGGTGGG + Intergenic
1147137883 17:38444558-38444580 GGGATGGCAGCCTCTGTGGATGG + Intronic
1147819199 17:43231677-43231699 GGGAATGCTGCCTCTCTGCTCGG + Intergenic
1147819785 17:43234708-43234730 GGGAACGCTGCCTCTCTGCTCGG + Intergenic
1147821097 17:43242106-43242128 GGGAACGCTGCCTCTCTGCTCGG + Intergenic
1147821903 17:43246595-43246617 GGGAACGCTGCCTCTCTGCTCGG + Intergenic
1147825505 17:43267554-43267576 GGGAACGCTGCCTCTCTGCTCGG + Intergenic
1147826636 17:43274021-43274043 GGGAACGCTGCCTCTCTGCTCGG + Intergenic
1147827525 17:43278899-43278921 GGGAACGCTGCCTCTCTGCTCGG + Intergenic
1147828633 17:43285060-43285082 GGGAACGCTGCCTCTCTGCTCGG + Intergenic
1147829736 17:43291211-43291233 GGGAACGCTGCCTCTCTGCTCGG + Intergenic
1147830820 17:43297333-43297355 GGGAACGCTGCCTCTCTGCTCGG + Intergenic
1147831519 17:43300962-43300984 GGGAACGCTGCCTCTCTGCTCGG + Intergenic
1148559176 17:48596321-48596343 GGGAAGGAAGGCTCTCGGGTGGG - Exonic
1151874917 17:76862336-76862358 AGGAGGGCTGCCTGTCTGGTTGG + Intergenic
1151951521 17:77356780-77356802 GGGTGGGCACCCTGTCTGGTGGG + Intronic
1152331398 17:79675326-79675348 GGGAGGGCAGCCTATCCAGGAGG - Intergenic
1154494827 18:14947952-14947974 GGGAAAGGAGCCTACCTGGCCGG - Intergenic
1158396133 18:57079551-57079573 GGGAAGGCAGCCGAGCAGGCAGG - Intergenic
1159103798 18:63982932-63982954 GAGAAGGCAGCCTCTCTGAAGGG - Intronic
1159261128 18:66014699-66014721 GAGAAGGCATCCTATTTGATGGG + Intergenic
1161958264 19:7508079-7508101 GGCAGGGCAGGCTAGCTGGTCGG - Intronic
1162255537 19:9486339-9486361 GGGAAGGCTGCCTGTCTTGTTGG - Intronic
1162528656 19:11222720-11222742 GTGAAGGCAGCCCACCTGGGAGG + Exonic
1163156078 19:15440571-15440593 GGGAGGGCATCCTATCTGAGCGG - Intronic
1163288700 19:16364858-16364880 GGGAAGGGAGCCGAGCTGGTGGG - Intronic
1163712823 19:18857013-18857035 GGGGAGGCAGCCCACCTGCTTGG - Exonic
1164738051 19:30556444-30556466 GGAGAGGCAGCCTCTCTGGATGG + Intronic
1166911157 19:46158932-46158954 AGGAAGGCAGCAGATCTGGCAGG - Intronic
925038965 2:715409-715431 GGGATGGAAGCAGATCTGGTGGG - Intergenic
926128480 2:10286091-10286113 GGGCAGGCAGCCTCTCCTGTGGG + Intergenic
926547722 2:14262706-14262728 GAGAAGGCAGCTTATGTGGCAGG + Intergenic
927651040 2:24913971-24913993 GGGAAGGCAGCCAGGATGGTTGG - Intronic
932345361 2:70991789-70991811 GGGGAGGCAGCTGATGTGGTTGG - Intronic
937207457 2:120245800-120245822 GGGAAGGCAGCATCTCTGGCAGG - Intronic
947825239 2:233101248-233101270 GTGAATGCAGCCACTCTGGTGGG - Intronic
948737259 2:240017083-240017105 GGGGAAGGAGCCTATCTGGGAGG - Intronic
948813209 2:240495873-240495895 GGAGAGGCAGCCTCTCTGGCTGG - Intronic
1169389454 20:5177773-5177795 TGGGAGGCAGCCTGTCTGTTGGG - Intronic
1171068038 20:22038257-22038279 GGGAAGGGAGCTAACCTGGTTGG + Intergenic
1171795231 20:29561260-29561282 GGAAAGGCAGCCTCTCTCCTGGG - Intergenic
1171853225 20:30323005-30323027 GGAAAGGCAGCCTCTCTCCTGGG + Intergenic
1172021425 20:31917012-31917034 GGGAAGGCAGCCAACAGGGTTGG + Intronic
1173229074 20:41180176-41180198 AGGAAGGCAGCCGCTCTGGTGGG - Exonic
1174406567 20:50306791-50306813 GGGAAGGAAGGATATCTGGTTGG - Intergenic
1175604162 20:60298828-60298850 GGACAGGCAGCCTTACTGGTGGG - Intergenic
1176679391 21:9811325-9811347 GGGGACGCAGCCTATCTGTCAGG - Intergenic
1176679673 21:9812732-9812754 GGGGACGCAGCCTATCTGTCAGG - Intergenic
1176679965 21:9814142-9814164 GGGGACGCAGCCTATCTGTCAGG - Intergenic
1176680248 21:9815551-9815573 GGGGACGCAGCCTATCTGTCAGG - Intergenic
1176680530 21:9816960-9816982 GGGGACGCAGCCTATCTGTCAGG - Intergenic
1176681101 21:9819772-9819794 GGGGACGCAGCCTATCTGTCAGG - Intergenic
1176681670 21:9822600-9822622 GGGGACGCAGCCTATCTGTCAGG - Intergenic
1176681946 21:9824009-9824031 GGGGACGCAGCCTATCTGTCAGG - Intergenic
1176682229 21:9825410-9825432 GGGGACGCAGCCTATCTGTCAGG - Intergenic
1176682508 21:9826819-9826841 GGGGACGCAGCCTATCTGTCAGG - Intergenic
1176682786 21:9828238-9828260 GGGGACGCAGCCTATCTGTCAGG - Intergenic
1176683066 21:9829635-9829657 GGGGACGCAGCCTATCTGTCAGG - Intergenic
1176683345 21:9831045-9831067 GGGGACGCAGCCTATCTGTCAGG - Intergenic
1176683625 21:9832454-9832476 GGGGACGCAGCCTATCTGTCAGG - Intergenic
1176683904 21:9833857-9833879 GGGGACGCAGCCTATCTGTCAGG - Intergenic
1176684182 21:9835266-9835288 GGGGACGCAGCCTATCTGTCAGG - Intergenic
1176684462 21:9836667-9836689 GGGAACGCAGCCTATCTGTCAGG - Intergenic
1176684743 21:9838069-9838091 GGGGACGCAGCCTATCTGTCAGG - Intergenic
1178404858 21:32315839-32315861 GGGCTGGCAGCCTATCGGGTAGG - Intronic
1182461091 22:30484671-30484693 GGGAAGGGACCCTAACTGATAGG + Intergenic
1183192200 22:36328916-36328938 AGGCAGGCAGCCTAGCTGGTCGG - Intronic
1183723638 22:39576626-39576648 GTGAAGGCCGCCTCTCTGCTCGG + Intronic
1185270053 22:49925574-49925596 GGGAGGGCAGCCTGTGTGGAGGG - Intronic
950275006 3:11653201-11653223 TGGACGGCACCCTAACTGGTTGG - Intronic
950702019 3:14757396-14757418 GGCAAGGCCGCCCACCTGGTGGG - Exonic
952206622 3:31186729-31186751 GGCAAGGCAGCCAAGCTGGCTGG + Intergenic
952497606 3:33929500-33929522 TTGAGGGCAGCCAATCTGGTCGG - Intergenic
955717808 3:61848923-61848945 GGGAAGTCAGGCCATCTGGCTGG + Intronic
955903114 3:63778494-63778516 AGGCAGGCAGCCTAGCTGTTTGG + Intergenic
960048665 3:113220736-113220758 GGAAAGGCAGCTTGTCTGGAGGG - Intronic
961106882 3:124249970-124249992 GGGAAGGCAGGCTAGCTAGAGGG + Intronic
961615506 3:128176200-128176222 GGGAAGGCAGGCTAGATGGATGG + Intronic
963506058 3:146186078-146186100 GGGGAGGCAGCCTGTCTGAAGGG + Intergenic
965821316 3:172687119-172687141 GGGAAGTAGGCCTATTTGGTTGG - Intronic
966313361 3:178618591-178618613 GGGAAGGTAATCTATCTGATTGG + Intronic
975363777 4:73503875-73503897 GGGAAGGCTTCCTATCTGTGTGG + Exonic
976681364 4:87759732-87759754 GGGAAGGAAGACTATCCAGTTGG - Intergenic
986308146 5:6530956-6530978 AGGAAGGCAGAAGATCTGGTAGG + Intergenic
986646336 5:9920122-9920144 GGGATGGCATACTATCTGGTTGG + Intergenic
987263329 5:16225812-16225834 GGGAAGGAGGCCCATGTGGTTGG + Intergenic
988309939 5:29543777-29543799 TTGAAGACAGCCTAGCTGGTTGG - Intergenic
996390887 5:122959993-122960015 GGGAAGGCAGCCTACTTCGGAGG - Intronic
996760679 5:126983300-126983322 GGGTGGGCAGGCGATCTGGTGGG + Intronic
997567403 5:134899525-134899547 GGGAAGAGGGCCTATTTGGTCGG - Exonic
1000176221 5:158757224-158757246 GGGAAGGCGGGCTCTCTGCTGGG + Intronic
1001670284 5:173468128-173468150 GGGAAGGCCTCCCATCTGGGAGG + Intergenic
1003156851 6:3603944-3603966 GGCAAGGCAGCCTACTTGGCTGG - Intergenic
1006094029 6:31644699-31644721 GGAAAGGCAGGCTTTCTGATTGG - Intronic
1007123292 6:39401436-39401458 GGGAAGGCAGCCAATCTAGGGGG + Intronic
1007124942 6:39418065-39418087 GGGAAGGCAGACACTCTGCTGGG - Intronic
1007708227 6:43804533-43804555 CGGAAAGCATCCTTTCTGGTGGG + Intergenic
1015481245 6:133712551-133712573 GAGAAGGCAGCCTATCAATTGGG - Intergenic
1018800458 6:167218144-167218166 GGGAAGGCAGCCTCAGGGGTCGG - Intergenic
1018809706 6:167289214-167289236 GGGAAGGCAGCCTCAGGGGTCGG + Intronic
1026447969 7:70501984-70502006 GGGAAAGCAGCCTGGCTGGGTGG - Intronic
1030112364 7:106037856-106037878 GGCAGGGCAGCCTATGTGATTGG - Intergenic
1032486178 7:132289131-132289153 GTGAAGCCAGCCTCTCTGGAGGG - Intronic
1033391843 7:140936306-140936328 GCTAAGGCAGACTCTCTGGTTGG + Intergenic
1033431132 7:141290693-141290715 AGGAAGGAAGACTATCTTGTGGG - Intronic
1038485082 8:27929339-27929361 GGGAAGGCAGCCTATCTGGTTGG - Intronic
1044638421 8:94352623-94352645 GGGACTGCAGCCTCTGTGGTTGG + Intergenic
1045309282 8:100986450-100986472 GGGAAGGGAGGCCATCTGATGGG + Intergenic
1049336431 8:142089131-142089153 GGAAAAACGGCCTATCTGGTTGG + Intergenic
1054154131 9:61628468-61628490 GGAAAGGCAGCCTCTCTCCTGGG - Intergenic
1054160917 9:61671677-61671699 GGGGACGCAGCCTATCTGTCAGG - Intergenic
1054172822 9:61856487-61856509 GGGGACGCAGCCTATCTGTCAGG + Intergenic
1054447677 9:65385521-65385543 GGGGACGCAGCCTATCTGTCCGG + Intergenic
1054664718 9:67724314-67724336 GGGGACGCAGCCTATCTGTCAGG - Intergenic
1054721614 9:68609521-68609543 GGCAGTGCAGCCTATTTGGTTGG + Intergenic
1057146679 9:92763817-92763839 GGGAAGTCATGCTAGCTGGTGGG + Intronic
1060045744 9:120338663-120338685 GGGAAGGCAGCCTAGAAGGGTGG - Intergenic
1060513692 9:124252348-124252370 GGGCAGGCAGCCTCTCTTGCAGG - Intergenic
1060752490 9:126182565-126182587 GGTCAGGGAGCCTGTCTGGTTGG + Intergenic
1060803384 9:126558594-126558616 GGGCAGGCAGCCGGGCTGGTGGG - Intergenic
1061008870 9:127943684-127943706 GGGAAAGAAACCAATCTGGTTGG - Intronic
1203664561 Un_KI270754v1:13861-13883 GGGGACGCAGCCTATCTGTCAGG - Intergenic
1203664845 Un_KI270754v1:15267-15289 GGGGACGCAGCCTATCTGTCAGG - Intergenic
1203665131 Un_KI270754v1:16676-16698 GGGGACGCAGCCTATCTGTCAGG - Intergenic
1203665688 Un_KI270754v1:19493-19515 GGGGACGCAGCCTATCTGTCAGG - Intergenic
1203665978 Un_KI270754v1:20903-20925 GGGGACGCAGCCTATCTGTCAGG - Intergenic
1203666267 Un_KI270754v1:22312-22334 GGGGACGCAGCCTATCTGTCAGG - Intergenic
1203666557 Un_KI270754v1:23719-23741 GGGGACGCAGCCTATCTGTCAGG - Intergenic
1203666838 Un_KI270754v1:25131-25153 GGGGACGCAGCCTATCTGTCAGG - Intergenic
1203667124 Un_KI270754v1:26542-26564 GGGGACGCAGCCTATCTGTCAGG - Intergenic
1203667416 Un_KI270754v1:27951-27973 GGGGACGCAGCCTATCTGTCAGG - Intergenic
1203667706 Un_KI270754v1:29358-29380 GGGGACGCAGCCTATCTGTCAGG - Intergenic
1203667987 Un_KI270754v1:30770-30792 GGGGACGCAGCCTATCTGTCAGG - Intergenic
1203668272 Un_KI270754v1:32181-32203 GGGGACGCAGCCTATCTGTCAGG - Intergenic
1203668564 Un_KI270754v1:33590-33612 GGGGACGCAGCCTATCTGTCAGG - Intergenic
1203668850 Un_KI270754v1:35000-35022 GGGGACGCAGCCTATCTGTCAGG - Intergenic
1203669409 Un_KI270754v1:37816-37838 GGGGACGCAGCCTATCTGTCAGG - Intergenic
1203669697 Un_KI270754v1:39223-39245 GGGGACGCAGCCTATCTGTCAGG - Intergenic
1189201927 X:39203787-39203809 GGGAAGGCTGCCTGGGTGGTGGG + Intergenic
1191740513 X:64432487-64432509 GGGAAGGCAGCTCCTCTGGTGGG - Intergenic
1192317835 X:70066224-70066246 GGGAAGGAAGCCTGGCTGGGAGG + Intergenic
1192318271 X:70068039-70068061 GGGAAGGAAGCCTAGCTGGGAGG + Intergenic
1195247281 X:103005859-103005881 GGGAAAGGAGTCCATCTGGTAGG + Intergenic
1199751810 X:150826776-150826798 CGGAAGGCAGCCTGTGTGGCTGG - Intronic
1200158727 X:153993203-153993225 GGGAAGGCAGCCTGTCTGGACGG - Intergenic