ID: 1038485083

View in Genome Browser
Species Human (GRCh38)
Location 8:27929343-27929365
Sequence TTGGGGGAAGGCAGCCTATC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 166
Summary {0: 1, 1: 0, 2: 1, 3: 26, 4: 138}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1038485083_1038485093 12 Left 1038485083 8:27929343-27929365 CCAGATAGGCTGCCTTCCCCCAA 0: 1
1: 0
2: 1
3: 26
4: 138
Right 1038485093 8:27929378-27929400 CCCTACAGTGCCAGCTGGGTAGG No data
1038485083_1038485090 7 Left 1038485083 8:27929343-27929365 CCAGATAGGCTGCCTTCCCCCAA 0: 1
1: 0
2: 1
3: 26
4: 138
Right 1038485090 8:27929373-27929395 GGTGTCCCTACAGTGCCAGCTGG No data
1038485083_1038485098 29 Left 1038485083 8:27929343-27929365 CCAGATAGGCTGCCTTCCCCCAA 0: 1
1: 0
2: 1
3: 26
4: 138
Right 1038485098 8:27929395-27929417 GGTAGGTACATGTGTATGGGAGG No data
1038485083_1038485097 26 Left 1038485083 8:27929343-27929365 CCAGATAGGCTGCCTTCCCCCAA 0: 1
1: 0
2: 1
3: 26
4: 138
Right 1038485097 8:27929392-27929414 CTGGGTAGGTACATGTGTATGGG No data
1038485083_1038485096 25 Left 1038485083 8:27929343-27929365 CCAGATAGGCTGCCTTCCCCCAA 0: 1
1: 0
2: 1
3: 26
4: 138
Right 1038485096 8:27929391-27929413 GCTGGGTAGGTACATGTGTATGG No data
1038485083_1038485099 30 Left 1038485083 8:27929343-27929365 CCAGATAGGCTGCCTTCCCCCAA 0: 1
1: 0
2: 1
3: 26
4: 138
Right 1038485099 8:27929396-27929418 GTAGGTACATGTGTATGGGAGGG No data
1038485083_1038485091 8 Left 1038485083 8:27929343-27929365 CCAGATAGGCTGCCTTCCCCCAA 0: 1
1: 0
2: 1
3: 26
4: 138
Right 1038485091 8:27929374-27929396 GTGTCCCTACAGTGCCAGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1038485083 Original CRISPR TTGGGGGAAGGCAGCCTATC TGG (reversed) Intronic
902117036 1:14129599-14129621 TTGGGGGAAGGCACCTTGTTGGG + Intergenic
903781471 1:25822873-25822895 TTGGGTGAGGGCAGCCTCTTGGG + Intronic
904870317 1:33613569-33613591 TTGGGAGAAAGCAGTCTAACTGG - Intronic
907914751 1:58858457-58858479 CTGGGGGAAGGCAGCAGAGCAGG - Intergenic
912877633 1:113378058-113378080 TTGGAGGAAGGCAGTCTTTCTGG - Intergenic
913530022 1:119727149-119727171 TTTGGGAAAGGCAGCATGTCTGG + Intronic
914195777 1:145447257-145447279 TTGTGGGAAGGCAGCGTCTCTGG + Intergenic
914195785 1:145447316-145447338 TTGCGGGAAGGCAGCGTCTCTGG + Intergenic
914195793 1:145447375-145447397 TTGCGGGAAGGCAGCGTCTCTGG + Intergenic
914195801 1:145447434-145447456 TTGCGGGAAGGCAGCGTCTCTGG + Intergenic
914195809 1:145447493-145447515 TTGCGGGAAGGCAGCGTCTCTGG + Intergenic
914195817 1:145447552-145447574 TTGCGGGAAGGCAGCGTCTCTGG + Intergenic
914195825 1:145447611-145447633 TTGCGGGAAGGCAGCGTCTCTGG + Intergenic
914195833 1:145447670-145447692 TTGCGGGAAGGCAGCGTCTCTGG + Intergenic
914195841 1:145447729-145447751 TTGCGGGAAGGCAGCGTCTCTGG + Intergenic
914195849 1:145447788-145447810 TTGCGGGAAGGCAGCGTCTCTGG + Intergenic
914195857 1:145447847-145447869 TTGTGGGAAGGCAGCGTCTCTGG + Intergenic
915094320 1:153449431-153449453 TTGGGGGAAGGCAGAGTGTATGG - Intergenic
919977684 1:202623386-202623408 AGGTGGGAAGGCAGCCTGTCTGG - Intronic
921668417 1:217900377-217900399 TGGGGGGAAGGGAGCCTATTTGG + Intergenic
923697004 1:236263093-236263115 TTTGGGGAAGGCAGGGAATCAGG - Intronic
1062953089 10:1519906-1519928 TTGGCAGAAGGCAGCCTACATGG - Intronic
1070062851 10:73001978-73002000 ATGGGGAAAGGCAGCATGTCTGG - Intergenic
1074418399 10:113287090-113287112 TTGGGGGAGGGCTGCCTATCAGG + Intergenic
1074632392 10:115273082-115273104 TAGGGGGATGGCACCATATCAGG + Intronic
1075554893 10:123423247-123423269 TTGGGGAAAGGCATCACATCTGG - Intergenic
1076137907 10:128057431-128057453 ATGGAGGAAGGCAGCCCATGTGG + Intronic
1077420565 11:2448008-2448030 TTGGGGGCAGGAAGCCTAAGCGG - Intronic
1080306356 11:30840610-30840632 ATGTGGGAAGGCAGCCTGTGGGG + Intronic
1083721450 11:64605634-64605656 TTGGGGGAAGGTAGGGTACCAGG + Intergenic
1085302961 11:75469111-75469133 TTGGGGGAAGGCAATCAACCTGG - Intronic
1086816441 11:91378201-91378223 GTGGGGGAAGGGAGACCATCAGG - Intergenic
1088402856 11:109440448-109440470 TGGGGGGAAGGTAGCCTAAAAGG - Intergenic
1089045897 11:115502717-115502739 TTGGGGGCAAGCAGCCAACCCGG + Intronic
1089341875 11:117763606-117763628 TTGGGGAAAAGCAGCCTGGCTGG - Intronic
1091029647 11:132174046-132174068 TCCGTTGAAGGCAGCCTATCAGG - Intronic
1091231693 11:133991804-133991826 GTCGGGGGAGGGAGCCTATCAGG + Intergenic
1095499972 12:42827297-42827319 TTGTGGGTAGGTAGCCTCTCAGG + Intergenic
1095504099 12:42874114-42874136 TTGGGGGAAGGCAAAATATAAGG - Intergenic
1096475213 12:51905481-51905503 GTGGGGGATGGAAGACTATCTGG - Intergenic
1096569122 12:52509844-52509866 TTGGGGGAAGGGAGAGCATCAGG - Intergenic
1101998274 12:109540532-109540554 TTTGGAGAAGGCAGCCTGACTGG - Intergenic
1104580872 12:130009849-130009871 TTGAGGCAACGCTGCCTATCGGG - Intergenic
1108972559 13:56395107-56395129 TTGGGGGAAGGTAGGCAATGAGG + Intergenic
1109388367 13:61663726-61663748 TTGGGGGAAGGGTGACAATCAGG - Intergenic
1109389937 13:61680677-61680699 TTGGGTAAATGCAGCCAATCTGG - Intergenic
1112938708 13:104833441-104833463 TTGAGGAAAGGCAGCCTCACAGG - Intergenic
1119474492 14:74919267-74919289 TTGGGGAAAGGCAGCCGTACAGG + Intronic
1124493332 15:30171750-30171772 AGGTGGGAAGGCAGCCTGTCTGG - Intergenic
1124750202 15:32366575-32366597 AGGTGGGAAGGCAGCCTGTCTGG + Intergenic
1125285571 15:38088927-38088949 TTGGAAGAAGGGAGCCTAGCTGG + Intergenic
1129274209 15:74434529-74434551 TTGGGGGGAGGCAGCCCAGAAGG - Intergenic
1131423564 15:92327019-92327041 TTGGTGGAAAGCAGCTTATGGGG - Intergenic
1131639111 15:94270610-94270632 TAGGGGGTAGGCAGCCCACCTGG - Intronic
1132890840 16:2203829-2203851 CTAGGAGAAGGCAGCCTTTCAGG + Intergenic
1133889744 16:9867881-9867903 TGGGGGAAAGGCAGCAGATCAGG - Intronic
1135663547 16:24316760-24316782 TTGGGGGAAGCCAGATTAACTGG - Intronic
1137404540 16:48179259-48179281 TTGGGTGCAGGCAGCTTATTTGG - Intronic
1139503759 16:67388740-67388762 GTGGGGGAAGGGAGCCTCTCTGG - Intergenic
1141118719 16:81334256-81334278 TTGGGGGAAGGGAGGCTGTCGGG + Intronic
1144576374 17:16432307-16432329 GTGGGGGCAGGGAGCCTCTCTGG - Intronic
1146737276 17:35249416-35249438 TTAGGGAAAGGCAGACTATTGGG - Intronic
1147653089 17:42072924-42072946 GTGGGGGAAGGCAGCCAGTTTGG - Intergenic
1149113306 17:53061520-53061542 CTGGCTGAAGGCAGCCTAACCGG + Intergenic
1150097424 17:62389677-62389699 TTGGTGGAAGGCAGAGTATATGG - Intronic
1150217420 17:63478157-63478179 TCGGGGGAGAGCAGCCCATCAGG + Intergenic
1150270390 17:63860680-63860702 TTGGTGGAGGGAAGCCTATAAGG - Intergenic
1151402152 17:73862806-73862828 TTGGGTGAGGGCTGCCTAGCTGG + Intergenic
1152179250 17:78807522-78807544 TTGGAGGAATGCAGCCGTTCTGG + Exonic
1156921112 18:42523330-42523352 TTGGGGGGAAGCAGCATATTAGG + Intergenic
1158262668 18:55626123-55626145 TAGGGAGAAGGCAGCATATTTGG + Intronic
1161426992 19:4209066-4209088 TTCGGGGAAGGAAGCAGATCTGG + Intronic
1163667094 19:18608250-18608272 TTGGGGGATGGGAGCCTATAGGG + Intronic
1164672061 19:30077866-30077888 TTGGGGCAAGGCCTCCCATCTGG + Intergenic
1168465922 19:56601042-56601064 TTGGGAGAAGGCAGGGTGTCCGG + Intronic
926124386 2:10262990-10263012 TAGGGGTAAGGCAGCTTACCCGG + Intergenic
926363752 2:12114511-12114533 TTGGGAGAAGGGAGCCTGTATGG - Intergenic
929804082 2:45129326-45129348 TGGGGGGAAGGCAGCGTGTGAGG - Intergenic
931242588 2:60466486-60466508 TTGGGGGAAGGGAGCAGATGAGG + Intronic
931902900 2:66809385-66809407 TTGTTGGAAGGCACCATATCAGG + Intergenic
932212714 2:69945656-69945678 GTGGGTGAAGGCAGCGTGTCTGG + Intergenic
933212090 2:79581890-79581912 TTTGGGGAAGGCAGTCAATATGG + Intronic
933223346 2:79716454-79716476 GTGGGGGAAGGGAGACCATCAGG - Intronic
936101621 2:109586364-109586386 TTGAGGGAAGGAAACTTATCAGG + Intronic
947743655 2:232496753-232496775 TGGGGGGGAGGCCGCCTATGGGG - Intergenic
1168932708 20:1636758-1636780 TTGGTGGAAGTCACCCTATGTGG - Intronic
1171135001 20:22688014-22688036 TTGGGTGCAGGCAGCTTATGTGG - Intergenic
1172092608 20:32444826-32444848 TTGGGAGAAGGCAGTCCCTCTGG + Exonic
1172968722 20:38858075-38858097 TTGGGGGAAAGGAGACTCTCTGG + Intronic
1173176051 20:40765756-40765778 TTAGGGCAAGGCTGCCTCTCAGG - Intergenic
1173474958 20:43352478-43352500 TTGGGTGCAGGCAGTCTATTTGG + Intergenic
1182171581 22:28235290-28235312 TTGAGGGAAGGCAACAGATCAGG - Intronic
1182428959 22:30289212-30289234 CTGGGGGACCGCCGCCTATCCGG - Intronic
1184901363 22:47448461-47448483 GTGGGGGACGGCAGCCGAGCTGG - Intergenic
1185260163 22:49857080-49857102 TTGGAGGAAGTCAGCCCCTCAGG - Intronic
949310644 3:2694075-2694097 TTGGGCAAAGGCATCCTAGCAGG - Intronic
950697988 3:14719167-14719189 TATGAGGAAGGCAGCCTGTCAGG + Intronic
952996281 3:38885685-38885707 TTGGAGTTAGGCAGCCTATCAGG - Intronic
954455025 3:50593094-50593116 TGGGGTAAAGGCAGCCTCTCTGG - Intergenic
956186578 3:66568342-66568364 TTGGGGGAAGGGAGAGCATCAGG - Intergenic
957532673 3:81460627-81460649 CTGGGAGAAAGCAGCGTATCAGG + Intergenic
960428908 3:117544782-117544804 TTGGGGGAAGGGAGAGCATCAGG + Intergenic
961088365 3:124089682-124089704 CTTGGGGAAGGCAGCCAACCAGG + Intronic
961669338 3:128517715-128517737 GTGGGGGAAGGCAGGCTCTCAGG - Intergenic
961922485 3:130442540-130442562 TTGTGGGAAGGCAGCGAATTGGG - Intronic
963679441 3:148355328-148355350 TTGGGAGACGGAAGCCTATGGGG - Intergenic
967948503 3:194822843-194822865 TTGGGGGAAGGCAGCTGATGAGG - Intergenic
973550679 4:52032877-52032899 TTTGGAAAAGGCATCCTATCAGG + Intronic
973554300 4:52066641-52066663 TTGGGGGAAGGGAGAGCATCAGG - Intronic
977878566 4:102178014-102178036 TGGTGGGAAGGCAGACTATGTGG - Intergenic
982961993 4:161850902-161850924 GTGGGAGAAGGGAGACTATCTGG + Intronic
985707311 5:1408997-1409019 CCGGGGGAAGGCAGCCAAGCCGG - Intronic
990442981 5:55865351-55865373 TAGGAGGAAGGCAGCTTCTCTGG + Intronic
995353705 5:111213174-111213196 TTGGGAGAAAGGAGACTATCAGG - Intergenic
1001572788 5:172741574-172741596 GTGTGGGGAGGCAGCCTCTCTGG + Intergenic
1002304469 5:178275063-178275085 CTGGGGGAGGGCTGCCCATCCGG - Intronic
1006416247 6:33905804-33905826 TGGGAGGAAGGCAGGCTCTCTGG + Intergenic
1009620798 6:66073670-66073692 GTGGGGAAAGGGAGACTATCAGG + Intergenic
1010017950 6:71126078-71126100 GTGGGGGAAGGAAGCCTAGTGGG + Intergenic
1022319213 7:29272462-29272484 TTGGGGCAAGGCAGGCAATGAGG + Intronic
1022508439 7:30921069-30921091 CTGGGAGAAGGCAGCCTAAGTGG + Intronic
1024002013 7:45196182-45196204 TTGGGAGAATGCAGCGTTTCTGG + Intergenic
1026901540 7:74040124-74040146 TGGGGGGCAGGCAGCTTCTCTGG - Intronic
1029421487 7:100474174-100474196 CTGGGGGAAGGATGCCTACCAGG + Intronic
1032233741 7:130101478-130101500 TTGGGGGAAGGTGGAATATCAGG + Intronic
1032682330 7:134197711-134197733 TTGGGGGAAGACAGGGTATCAGG - Intronic
1034123997 7:148654775-148654797 GTGGGGGAAGGCAGCCTTTGTGG - Intergenic
1034538336 7:151739878-151739900 TTGGGGGAAGGCACGGTCTCTGG - Intronic
1034700140 7:153088442-153088464 TTGTTGGAAGGAAGCCTATGTGG + Intergenic
1038485083 8:27929343-27929365 TTGGGGGAAGGCAGCCTATCTGG - Intronic
1038874059 8:31528534-31528556 TTTGGGGAAGACAGAATATCGGG - Intergenic
1041413137 8:57578473-57578495 CAGAGGGAAGGCAGCCTTTCTGG + Intergenic
1047323100 8:123807698-123807720 TTGGAGGGTGGCAGCCTTTCAGG + Intronic
1047332568 8:123905221-123905243 TTGGGGGGAGGGAGAGTATCAGG - Intronic
1047992545 8:130301186-130301208 GTGGGGGAAGGTAGCCTAATGGG - Intronic
1048213777 8:132478735-132478757 TTCCGGGAAGGCACCCTCTCCGG + Intronic
1048280616 8:133102912-133102934 TAGGGGGAGGGCAGCCCATGTGG + Intronic
1049756837 8:144314503-144314525 TTGGGGGAAGGCAGACTGGCAGG - Exonic
1052379571 9:27755529-27755551 TTGGGGGAAGGGAGAGCATCAGG + Intergenic
1053652411 9:40182443-40182465 TATGGGTAAGGCAGCCTAACAGG - Intergenic
1053902811 9:42811751-42811773 TATGGGTAAGGCAGCCTAACAGG - Intergenic
1054532170 9:66193778-66193800 TATGGGTAAGGCAGCCTAACAGG + Intergenic
1056125968 9:83537257-83537279 TTGGGAGAAGGCAGCTTTGCTGG - Intronic
1058936453 9:109773781-109773803 TTGGGGAAAGGCAGTTTGTCCGG + Intronic
1060045746 9:120338667-120338689 GAGGGGGAAGGCAGCCTAGAAGG - Intergenic
1060212341 9:121718207-121718229 CTGGGAGAAGGCAGCCAGTCAGG - Intronic
1061667237 9:132167671-132167693 TCGGGGGAAGGCAGACATTCAGG + Intronic
1061869436 9:133513030-133513052 TTGGGGGATGCCAGGCCATCAGG + Intergenic
1062391081 9:136334099-136334121 TTGGGTGAAGGCAGGGTATGGGG + Intronic
1062698875 9:137888975-137888997 TTGCGGGAAGGCAGCGTCTCTGG - Intronic
1062698883 9:137889034-137889056 TTGCGGGAAGGCAGCGTCTCTGG - Intronic
1062698891 9:137889093-137889115 TTGTGGGAAGGCAGCGTCTCTGG - Intronic
1187207776 X:17199020-17199042 CTGGGGGAACCCAGACTATCAGG + Intergenic
1190634697 X:52422204-52422226 TTGGGAGAAGGAGGCCTATATGG + Intergenic
1190972331 X:55362567-55362589 TTGGGGGAAGGGAGAATATTAGG + Intergenic
1191190818 X:57665251-57665273 GTGGGGGAAGGCAGAACATCAGG + Intergenic
1193431081 X:81406829-81406851 TTGGGGGAAGCCAGCAAACCAGG + Intergenic
1194004228 X:88470612-88470634 TTGAGTTGAGGCAGCCTATCTGG + Intergenic
1195355557 X:104036494-104036516 TTGGGGGAAGTCAGTCTTTTTGG + Intergenic
1195429819 X:104776187-104776209 TTGGGGGTAGGCAAAATATCAGG + Intronic
1196850729 X:119935785-119935807 TTTGTGGAAGGCACCCTATCTGG - Intronic
1199665797 X:150095482-150095504 TTGGGGGAGGAAAGCCTAGCAGG + Intergenic
1200158728 X:153993207-153993229 AGCGGGGAAGGCAGCCTGTCTGG - Intergenic
1200973614 Y:9182563-9182585 CAAGGGGAAGGCAGCCTCTCAGG + Intergenic
1201395234 Y:13540357-13540379 TTGGAGGAAGGCAGGCACTCTGG - Intergenic
1202137466 Y:21681953-21681975 CAAGGGGAAGGCAGCCTCTCAGG - Intergenic