ID: 1038485085

View in Genome Browser
Species Human (GRCh38)
Location 8:27929355-27929377
Sequence ACACCTGATGTATTGGGGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 202
Summary {0: 1, 1: 0, 2: 1, 3: 22, 4: 178}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1038485085_1038485099 18 Left 1038485085 8:27929355-27929377 CCTTCCCCCAATACATCAGGTGT 0: 1
1: 0
2: 1
3: 22
4: 178
Right 1038485099 8:27929396-27929418 GTAGGTACATGTGTATGGGAGGG No data
1038485085_1038485097 14 Left 1038485085 8:27929355-27929377 CCTTCCCCCAATACATCAGGTGT 0: 1
1: 0
2: 1
3: 22
4: 178
Right 1038485097 8:27929392-27929414 CTGGGTAGGTACATGTGTATGGG No data
1038485085_1038485090 -5 Left 1038485085 8:27929355-27929377 CCTTCCCCCAATACATCAGGTGT 0: 1
1: 0
2: 1
3: 22
4: 178
Right 1038485090 8:27929373-27929395 GGTGTCCCTACAGTGCCAGCTGG No data
1038485085_1038485098 17 Left 1038485085 8:27929355-27929377 CCTTCCCCCAATACATCAGGTGT 0: 1
1: 0
2: 1
3: 22
4: 178
Right 1038485098 8:27929395-27929417 GGTAGGTACATGTGTATGGGAGG No data
1038485085_1038485096 13 Left 1038485085 8:27929355-27929377 CCTTCCCCCAATACATCAGGTGT 0: 1
1: 0
2: 1
3: 22
4: 178
Right 1038485096 8:27929391-27929413 GCTGGGTAGGTACATGTGTATGG No data
1038485085_1038485093 0 Left 1038485085 8:27929355-27929377 CCTTCCCCCAATACATCAGGTGT 0: 1
1: 0
2: 1
3: 22
4: 178
Right 1038485093 8:27929378-27929400 CCCTACAGTGCCAGCTGGGTAGG No data
1038485085_1038485100 25 Left 1038485085 8:27929355-27929377 CCTTCCCCCAATACATCAGGTGT 0: 1
1: 0
2: 1
3: 22
4: 178
Right 1038485100 8:27929403-27929425 CATGTGTATGGGAGGGAAGAAGG No data
1038485085_1038485091 -4 Left 1038485085 8:27929355-27929377 CCTTCCCCCAATACATCAGGTGT 0: 1
1: 0
2: 1
3: 22
4: 178
Right 1038485091 8:27929374-27929396 GTGTCCCTACAGTGCCAGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1038485085 Original CRISPR ACACCTGATGTATTGGGGGA AGG (reversed) Intronic
900964748 1:5950238-5950260 GCTCCTTAGGTATTGGGGGAAGG - Intronic
901467926 1:9434773-9434795 ACACCTTTTTTGTTGGGGGAAGG - Intergenic
902199237 1:14821565-14821587 ACACCAGTTGTATTGGGTTAGGG - Intronic
903911967 1:26734041-26734063 TCAACTGAGGAATTGGGGGAAGG + Intronic
904587523 1:31588456-31588478 ATACCTGAAATATTGGGTGAAGG - Intergenic
905011363 1:34749126-34749148 ATCCCTGATGTATTGGGGGGTGG + Intronic
906063212 1:42961644-42961666 TCACCAGATGGATTGAGGGAAGG + Intergenic
906664496 1:47609695-47609717 AATCCCCATGTATTGGGGGAGGG - Intergenic
907610492 1:55865078-55865100 AATCCTCATGTGTTGGGGGAGGG + Intergenic
907939917 1:59077726-59077748 ACAACAGATGTCTTTGGGGAAGG - Intergenic
908055096 1:60277475-60277497 ACACCTGTTCTATTGGAGTAAGG + Intergenic
911214049 1:95172819-95172841 ACATCTAATGTATTGGGGTAGGG + Intronic
911734008 1:101317580-101317602 ACATCTGCTATAATGGGGGAGGG + Intergenic
912776301 1:112508370-112508392 AAACGTGATGCATTGGGGGTGGG + Intronic
913028574 1:114873232-114873254 ACACATGATGTACTGGGTAAAGG + Intronic
920707795 1:208267183-208267205 ACAACTCATGCATTGAGGGAGGG + Intergenic
920975326 1:210780500-210780522 ACAGCAGATGCAGTGGGGGAAGG + Intronic
922740648 1:228012509-228012531 ACACCTGGAGTAATGGGGGTGGG + Intronic
1063549806 10:7020157-7020179 AAACCTCGTGTATTGTGGGAGGG - Intergenic
1066542146 10:36458816-36458838 AATCCCCATGTATTGGGGGAAGG - Intergenic
1067261015 10:44691483-44691505 ACACCTGAGGTAGAGGGGGAAGG - Intergenic
1069918725 10:71803096-71803118 ACCCATGATGTCTTGGGGGGTGG + Intronic
1070136636 10:73699700-73699722 AATCCTGATGTGTTGAGGGAGGG - Intergenic
1076759148 10:132591832-132591854 TCACCTGACATATCGGGGGAGGG - Intronic
1078333569 11:10445849-10445871 ACTCCTAATGCACTGGGGGATGG - Intronic
1079600918 11:22312925-22312947 CCACCTGATGCATTGGGAGTTGG + Intergenic
1080480816 11:32648001-32648023 ACAGCTGAGGTTTGGGGGGAAGG - Intronic
1080938249 11:36885072-36885094 ACAACTGAACTATTGGGGGCTGG - Intergenic
1081797690 11:45832806-45832828 GGACCTGATGTGGTGGGGGATGG - Intergenic
1086309869 11:85523074-85523096 AATCCCCATGTATTGGGGGAGGG + Intronic
1087965108 11:104403292-104403314 GCACCTTATTTACTGGGGGAGGG + Intergenic
1088205051 11:107382886-107382908 ACACCCTATGCAATGGGGGAAGG + Intronic
1089796159 11:120983026-120983048 ACTCCTGATTTCTTGGGAGATGG - Intronic
1090810336 11:130234483-130234505 TAACCTGATGTATTGGTGGTGGG - Intronic
1091570857 12:1684198-1684220 ACACCTGAGGTATTGCGGGCAGG - Intergenic
1092470732 12:8777723-8777745 ACAGCTGCATTATTGGGGGAAGG - Intronic
1093190220 12:16065656-16065678 ACACCTGATACATGGGGGCAAGG + Intergenic
1094308046 12:29043252-29043274 ACATGTCATGTTTTGGGGGAGGG - Intergenic
1096238159 12:49943607-49943629 CCTCCAGATGTAATGGGGGAAGG + Intergenic
1096351411 12:50904179-50904201 CCACCTGATGCATTGGGAGTTGG + Intergenic
1097713545 12:62940152-62940174 ACACCTGATTTATTGGGGGTCGG + Intergenic
1101363769 12:104052661-104052683 ACACCTGCTGGATTGTGTGAGGG - Intronic
1102420599 12:112800173-112800195 ACAAGTGATGGGTTGGGGGAGGG + Intronic
1105552647 13:21411876-21411898 AAACCTAATATCTTGGGGGAGGG - Intronic
1107740791 13:43447725-43447747 ACAGCTGATGGATTGGTGTAAGG + Intronic
1107847858 13:44536125-44536147 ATAGCTGTTGTATTGGGGGTGGG - Intronic
1109166650 13:59043368-59043390 ACAAATGATTTACTGGGGGAAGG - Intergenic
1109853619 13:68101364-68101386 AAACCTCATGTGTTGTGGGAGGG - Intergenic
1112398024 13:99051135-99051157 TCACCTGAAGCAATGGGGGAGGG + Intronic
1115583177 14:34782918-34782940 ACACCTGTGATATTGGTGGAGGG + Intronic
1116658032 14:47675235-47675257 GCAACTGATGGAATGGGGGAAGG - Intergenic
1117175476 14:53141898-53141920 AAACCTGTTGTATTTGGGGTTGG - Intronic
1122955671 14:105069787-105069809 ACACCTGATGGAGGGAGGGATGG - Intergenic
1125289592 15:38130974-38130996 AGGCCTGAGGTACTGGGGGATGG + Intergenic
1125383493 15:39112549-39112571 AGCCCCCATGTATTGGGGGAGGG + Intergenic
1125989137 15:44088589-44088611 ACACCCAAGGTTTTGGGGGAAGG - Intronic
1127073632 15:55306125-55306147 CCACCTGATGCATTGGGAGTTGG + Intronic
1131950387 15:97675153-97675175 AAACATGATGTACTGGGTGAGGG + Intergenic
1134426228 16:14148814-14148836 ACACATGATGTAATGAGGAAGGG - Intronic
1137993824 16:53186665-53186687 AATCCTTATGTATTGTGGGAAGG + Intronic
1138122435 16:54411427-54411449 ACACCTGAGCTAGTGGGGCAGGG + Intergenic
1138411632 16:56845139-56845161 AGAGCTGATGATTTGGGGGATGG - Intronic
1143516693 17:7422797-7422819 AGCCCTGATTTATTTGGGGAGGG + Intergenic
1145796455 17:27658375-27658397 ACTTAAGATGTATTGGGGGATGG - Intergenic
1145810890 17:27763650-27763672 ACTTAAGATGTATTGGGGGATGG - Intronic
1146997731 17:37335408-37335430 CCACCTGATGCATTGGGAGTTGG - Intronic
1147326879 17:39673859-39673881 ACAGCTGATGTGTTGGGGGTTGG + Intronic
1152560174 17:81074192-81074214 ACAGCTGCAGTATTGGGGGCAGG + Intronic
1156083908 18:33376257-33376279 ACTCCTGGTGTGTTGGGGGAGGG + Intronic
1157541821 18:48516070-48516092 ACACCAGATACATTGGGGCAGGG - Intergenic
1162842917 19:13369436-13369458 GCACCTGCTTTATTGGGGGACGG - Intronic
1163740672 19:19009905-19009927 ACTCCTGCTGGCTTGGGGGATGG + Exonic
1165708007 19:37990046-37990068 TCACCTGGTGGAGTGGGGGAGGG + Intronic
1165756572 19:38296718-38296740 ACATCTTGTGTGTTGGGGGAGGG - Intronic
1168172777 19:54600298-54600320 ACTCCTGAGGCATTTGGGGAGGG - Intronic
925645278 2:6029538-6029560 ACAAATGAGGAATTGGGGGAGGG + Intergenic
926451147 2:13005821-13005843 ATGCCTGATGTATTGGAGAAGGG - Intergenic
927609401 2:24523278-24523300 ACCCATGATGTATGGGGAGAAGG - Intronic
928105662 2:28469144-28469166 ACACCTACTGTCCTGGGGGAAGG + Intronic
928131585 2:28655539-28655561 ACACCTCATGTACTGGGGACAGG + Intergenic
931614349 2:64140957-64140979 ACACTTGTGGTAGTGGGGGAGGG - Intronic
931661765 2:64571595-64571617 ACACCTATTTTATTGGGGAAGGG + Intronic
935943835 2:108268752-108268774 ACACCTGCTCTATGGAGGGAGGG + Intergenic
936010262 2:108921027-108921049 AGACCTGATGAATCGGGGGTGGG + Intronic
936263406 2:110980965-110980987 ACCCCTGGTGTGCTGGGGGAGGG - Intronic
938944890 2:136203127-136203149 CCACCTGATGGATTGGGAGTTGG + Intergenic
941416617 2:165229262-165229284 AGACCTGACTTATTGGGGCATGG + Intergenic
942515758 2:176751112-176751134 ACATATGGTGTAATGGGGGATGG + Intergenic
944667212 2:201968094-201968116 ACACCAGTTGTATTGGCTGAGGG - Intergenic
945696021 2:213105371-213105393 ACACCAGAGGTTTTGGGGGAAGG + Intronic
946348417 2:219130107-219130129 AAGCCTGATGTTTTGTGGGACGG - Intronic
946874620 2:224115098-224115120 AAACCTTATGTGTTGGGGGAGGG + Intergenic
947055682 2:226099286-226099308 ACACCAGATGTATTGGATTAAGG + Intergenic
948624976 2:239263277-239263299 ACAGCTGATGTGTAGGGGGCTGG - Intronic
948829209 2:240589584-240589606 TCTCCTGCTGTGTTGGGGGAAGG + Intronic
948858160 2:240740240-240740262 ACACCTGGTGGGGTGGGGGAGGG + Intronic
1169294258 20:4379261-4379283 ACACCTGTTCTATTGGGGTAGGG + Intergenic
1171416280 20:24982809-24982831 TCCCCTGATGTGTTGAGGGAGGG - Intronic
1174726914 20:52872183-52872205 CCACCTGATACATTGGGGGGTGG + Intergenic
1174856606 20:54051402-54051424 ATACCACATGTATTGGGGGGAGG + Intronic
1174977556 20:55351779-55351801 CCACCTGATGCATTGGGAGTTGG - Intergenic
1175520344 20:59598786-59598808 ACACCTGAAGTAGTGGCGGGTGG - Intronic
1179504340 21:41830949-41830971 ACATCTGATGGATGGGGGCAGGG - Intronic
1180568126 22:16692567-16692589 AGACCTGATGTAAGGAGGGAAGG + Intergenic
1181883500 22:26000117-26000139 ACACCTTATGTGTTGGGACAGGG + Intronic
1182342288 22:29633069-29633091 AAACCTCATGCATTTGGGGAAGG + Intronic
1182966395 22:34525542-34525564 AATCCTCATGTGTTGGGGGAAGG - Intergenic
1183565580 22:38612061-38612083 AGACCTGACGCATTGGGAGATGG - Intronic
1183874289 22:40765765-40765787 ACACCTCATGAATAGGGGTAGGG - Intergenic
1184082407 22:42232484-42232506 ACAACAGATGTTTTGGGGGTGGG + Intronic
949557108 3:5164092-5164114 ACACCTAATATATAGGGGGTGGG - Intronic
949947371 3:9201254-9201276 TCACCTGAGGTCTTGGGGGCTGG - Intronic
953552322 3:43913157-43913179 ACAAATGCTGTTTTGGGGGAGGG - Intergenic
953610250 3:44441791-44441813 AGACCTGATGGATTTGGGGAGGG - Exonic
954376154 3:50195156-50195178 ACACCTGAGGTCTTGGGGCGGGG - Intronic
954922687 3:54205231-54205253 TCACCTAGTGTAATGGGGGATGG + Intronic
958629406 3:96668073-96668095 CCACCTGATGCATTGGGAGTTGG + Intergenic
959364015 3:105433691-105433713 ATAAGTGATGTTTTGGGGGATGG - Intronic
959364044 3:105433980-105434002 ATAAGTGATGTTTTGGGGGATGG - Intronic
960658615 3:120033642-120033664 AATCCTCATGTATTGGAGGAGGG + Intronic
961765290 3:129205710-129205732 ATACCTGATGGAGTGGGGGCGGG - Intergenic
963126322 3:141820257-141820279 TCACCTGATGCATTGGGAGTTGG - Intergenic
963694656 3:148550721-148550743 ACACAGGAGGTATTGGGCGAAGG - Intergenic
964529206 3:157648907-157648929 ATAACTGATCTACTGGGGGACGG - Intronic
966428445 3:179806281-179806303 ACAGCTGATGTGTAGGGGGGTGG + Intronic
967199908 3:187063798-187063820 ACACAGGAAGTGTTGGGGGAGGG - Intronic
967453050 3:189649121-189649143 ACACATGATATATTGGGTGGTGG + Intronic
969123136 4:4924362-4924384 ACACCTGGTGTGTGGGGGGGGGG - Intergenic
969884389 4:10202269-10202291 ACACCTGATGTGTTGGGTGCTGG - Intergenic
972873544 4:43329870-43329892 TCACCTGGTGGATTGGGTGAGGG + Intergenic
976189999 4:82478391-82478413 CCACCTGATGCATTGGGAGTTGG - Intergenic
979604457 4:122623040-122623062 ACCCCTGATGTACTGGTGGATGG - Intergenic
980872136 4:138623457-138623479 CCACCTGATGCATTGGGAGTTGG + Intergenic
981276189 4:142900707-142900729 ACAGCAGGTGAATTGGGGGAGGG + Intergenic
981775036 4:148356995-148357017 ACACCTGCTATTATGGGGGAGGG + Intronic
982089345 4:151866977-151866999 ACACCAGATGTATTGGATGACGG + Intergenic
982494147 4:156068885-156068907 ACATCTTATGTAGTTGGGGACGG - Intergenic
983181811 4:164656904-164656926 CCACCTGATGCATTGGGAGTTGG - Intergenic
987737962 5:21869348-21869370 ACAGCTGATGTACTTGTGGAAGG + Intronic
988299678 5:29405659-29405681 AATCCCCATGTATTGGGGGAGGG + Intergenic
988411314 5:30889240-30889262 ACACCAGTTGTATTGGAGTAGGG + Intergenic
990442279 5:55858948-55858970 ACACATGATATAGTGGGGCATGG + Intronic
991316499 5:65313937-65313959 AGACATGATGTATTGGGTAATGG - Intronic
993622135 5:90180830-90180852 AGACCAGATGTATTGGAGTAGGG - Intergenic
993954372 5:94214483-94214505 ACACTTCAGGTATTGGGGGAAGG - Intronic
996397367 5:123026802-123026824 ACCCTTGAGGTATTGGAGGATGG - Intronic
997384094 5:133458916-133458938 ACACCTGTTGTAGACGGGGACGG + Intronic
997386080 5:133473948-133473970 AATCCCCATGTATTGGGGGAGGG - Intronic
997862356 5:137429351-137429373 AGACCTGATATAATGGGGGTGGG - Intronic
998511854 5:142720387-142720409 ACAGCTGATGGATAGGAGGAAGG + Intergenic
998812508 5:145980264-145980286 ACACCTAATTAATTTGGGGAGGG - Intronic
999327172 5:150650523-150650545 ACCCCTGTTGTAGTAGGGGAGGG - Exonic
1008233648 6:49016341-49016363 ACACCAGTTGTATTGGGTTAAGG - Intergenic
1008381356 6:50842518-50842540 TTACCTGCAGTATTGGGGGAGGG - Intronic
1009051455 6:58281764-58281786 AATCCTGATGTGTTGGGGGAGGG + Intergenic
1012618038 6:101302222-101302244 AATCCCCATGTATTGGGGGAGGG + Intergenic
1013022650 6:106234507-106234529 CCACCTGATGCATTGGGAGTTGG - Intronic
1016256626 6:142114007-142114029 ACCCCTGGGGGATTGGGGGATGG - Intergenic
1016928761 6:149381365-149381387 AAACCTGATGTTTTGATGGAAGG - Intronic
1018050917 6:160006666-160006688 ACACCTGAAGTCTTGGGGCAGGG - Intronic
1018211834 6:161489755-161489777 AGACCTGATTTATTAGGTGAAGG + Intronic
1027408534 7:77888498-77888520 ACACTGGAGGCATTGGGGGAGGG + Intronic
1028587905 7:92469620-92469642 CCACCTGATGCATTGGGAGTTGG + Exonic
1029891717 7:103936666-103936688 ACAGCAGATTTCTTGGGGGAGGG - Intronic
1030139386 7:106289416-106289438 AAACCTGATTTTTTGTGGGAGGG + Intergenic
1030254286 7:107490447-107490469 TTACATGATGTAATGGGGGATGG + Intronic
1035292280 7:157847011-157847033 ACACATGATGTAGTGAGGGAGGG - Intronic
1035292315 7:157847291-157847313 ACACATGATGTAGTGAGGGAGGG - Intronic
1035292330 7:157847411-157847433 ACACCTGATGGAGTGAGAGAGGG - Intronic
1035292381 7:157847861-157847883 ACACATGATGTAATGAGAGAGGG - Intronic
1035292385 7:157847901-157847923 ACACATGATGTAATGAGAGAGGG - Intronic
1035292436 7:157848411-157848433 ACACATGATGTAATGAGAGAGGG - Intronic
1037883960 8:22586576-22586598 ACGGCTGATGTATTGGGGCTGGG + Intronic
1038485085 8:27929355-27929377 ACACCTGATGTATTGGGGGAAGG - Intronic
1039402228 8:37279583-37279605 ACACCTGGTGTGTTGGGCCATGG - Intergenic
1040037387 8:42883877-42883899 AATCATGATGTATTGGGGAAGGG - Intronic
1040640180 8:49324249-49324271 AATCCCCATGTATTGGGGGAGGG + Intergenic
1044190323 8:89308850-89308872 ATACATGATGAATTTGGGGATGG + Intergenic
1044413484 8:91910354-91910376 TCATCTGCTGTATTGAGGGAAGG - Intergenic
1046405125 8:113763307-113763329 GCACCAGATGGAGTGGGGGAGGG + Intergenic
1047337856 8:123953563-123953585 GCGCCTGATGCATTGGGGCATGG - Intronic
1047693152 8:127377103-127377125 ACACCAGTTGTATTGGGTTAGGG - Intergenic
1047731632 8:127733664-127733686 ACACTGGATTTATTGGGGAAAGG - Intergenic
1051466140 9:17380224-17380246 AGACCTGAGGCATTGGGGGAGGG + Intronic
1053409864 9:37908985-37909007 ACTCCTATTGTTTTGGGGGATGG + Intronic
1053930758 9:43112234-43112256 CCACCTGAAGTTTTGGGGTAAGG + Intergenic
1057150349 9:92791090-92791112 ACACATGTTGTCTTGGGGGATGG + Intergenic
1057736333 9:97664892-97664914 ACACCTGAGGGATGGGGGAAAGG + Intronic
1059089132 9:111336909-111336931 CCACCTGATGCATTGGGAGTTGG - Intergenic
1059519085 9:114922984-114923006 ACACCTGAGGTCTTGAGAGATGG + Intronic
1060213868 9:121726698-121726720 ACACCAGATGTGGTGGGGGCGGG - Intronic
1187001872 X:15189477-15189499 ATACTTGATGAATTGTGGGAAGG - Intergenic
1187625279 X:21105221-21105243 ACTCCTGGGGTTTTGGGGGAGGG + Intergenic
1189246897 X:39570317-39570339 ATATCTGATGAATTGGGGCAGGG - Intergenic
1193336583 X:80296856-80296878 ACAGTTCATGTATTGTGGGAAGG + Intergenic
1195021136 X:100829816-100829838 AAACCTGATGGATTGAGGGCTGG - Intronic
1195630780 X:107053373-107053395 CCACCTGATGCATTGGGAGCTGG + Intergenic
1196614539 X:117752889-117752911 ACACCTGTTCTCTTGGGGTATGG - Intergenic
1198532648 X:137561163-137561185 ACACCTGAAGAGATGGGGGAAGG - Intergenic
1199394750 X:147322592-147322614 ACACCTGATATAATGGCTGAAGG + Intergenic
1199879298 X:151960455-151960477 ACACCTGGTGTATTGTGGAAAGG + Intronic
1201253910 Y:12088455-12088477 ACACCTTTTGTATGGAGGGAGGG - Intergenic