ID: 1038485086

View in Genome Browser
Species Human (GRCh38)
Location 8:27929359-27929381
Sequence AGGGACACCTGATGTATTGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 150
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 138}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1038485086_1038485090 -9 Left 1038485086 8:27929359-27929381 CCCCCAATACATCAGGTGTCCCT 0: 1
1: 0
2: 0
3: 11
4: 138
Right 1038485090 8:27929373-27929395 GGTGTCCCTACAGTGCCAGCTGG No data
1038485086_1038485099 14 Left 1038485086 8:27929359-27929381 CCCCCAATACATCAGGTGTCCCT 0: 1
1: 0
2: 0
3: 11
4: 138
Right 1038485099 8:27929396-27929418 GTAGGTACATGTGTATGGGAGGG No data
1038485086_1038485096 9 Left 1038485086 8:27929359-27929381 CCCCCAATACATCAGGTGTCCCT 0: 1
1: 0
2: 0
3: 11
4: 138
Right 1038485096 8:27929391-27929413 GCTGGGTAGGTACATGTGTATGG No data
1038485086_1038485093 -4 Left 1038485086 8:27929359-27929381 CCCCCAATACATCAGGTGTCCCT 0: 1
1: 0
2: 0
3: 11
4: 138
Right 1038485093 8:27929378-27929400 CCCTACAGTGCCAGCTGGGTAGG No data
1038485086_1038485100 21 Left 1038485086 8:27929359-27929381 CCCCCAATACATCAGGTGTCCCT 0: 1
1: 0
2: 0
3: 11
4: 138
Right 1038485100 8:27929403-27929425 CATGTGTATGGGAGGGAAGAAGG No data
1038485086_1038485097 10 Left 1038485086 8:27929359-27929381 CCCCCAATACATCAGGTGTCCCT 0: 1
1: 0
2: 0
3: 11
4: 138
Right 1038485097 8:27929392-27929414 CTGGGTAGGTACATGTGTATGGG No data
1038485086_1038485098 13 Left 1038485086 8:27929359-27929381 CCCCCAATACATCAGGTGTCCCT 0: 1
1: 0
2: 0
3: 11
4: 138
Right 1038485098 8:27929395-27929417 GGTAGGTACATGTGTATGGGAGG No data
1038485086_1038485101 30 Left 1038485086 8:27929359-27929381 CCCCCAATACATCAGGTGTCCCT 0: 1
1: 0
2: 0
3: 11
4: 138
Right 1038485101 8:27929412-27929434 GGGAGGGAAGAAGGAAGCTAAGG No data
1038485086_1038485091 -8 Left 1038485086 8:27929359-27929381 CCCCCAATACATCAGGTGTCCCT 0: 1
1: 0
2: 0
3: 11
4: 138
Right 1038485091 8:27929374-27929396 GTGTCCCTACAGTGCCAGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1038485086 Original CRISPR AGGGACACCTGATGTATTGG GGG (reversed) Intronic
905924127 1:41737875-41737897 AGTGACACCTGCTGTATTTTAGG - Intronic
918207885 1:182325552-182325574 AGGGTCACCTGGTGTTCTGGAGG - Intergenic
923120198 1:230983038-230983060 AGGGACACATGATATATTAGAGG - Intronic
1063001102 10:1923881-1923903 AGTGACACCTGCTTTATGGGCGG + Intergenic
1063843275 10:10096055-10096077 AGGAAGACCTGATGTACTGTGGG + Intergenic
1065500060 10:26372018-26372040 AGGGACAGCTGATGGGTTGTAGG - Intergenic
1072445103 10:95492607-95492629 AGGGGCACCTGATGCAGTGGAGG + Intronic
1075124233 10:119686942-119686964 AGGGATATCTTATTTATTGGAGG - Intergenic
1076251739 10:128989925-128989947 GGGGACATCTCATGTATTTGTGG + Intergenic
1087175032 11:95088802-95088824 AAGGGAACATGATGTATTGGAGG - Intergenic
1088129661 11:106472250-106472272 AGAGAGACCTGATGAAATGGTGG + Intergenic
1090191430 11:124772210-124772232 AGGGACACCTGAAGTATTTTGGG - Intronic
1090454602 11:126837442-126837464 AGAGAAACCTGGTGAATTGGTGG + Intronic
1091570859 12:1684202-1684224 AGCCACACCTGAGGTATTGCGGG - Intergenic
1092087412 12:5774645-5774667 AAGGACACCTGATGCCTTGTTGG + Intronic
1093474757 12:19542751-19542773 AGAGGCCCCTGATGTAATGGTGG + Intronic
1093835901 12:23828052-23828074 TGGGACCCCTGATGTATACGTGG - Intronic
1094321602 12:29190007-29190029 AAGGACAACTCATGGATTGGAGG + Intronic
1095181739 12:39154257-39154279 AAGGAAACCTGCTGTCTTGGAGG - Intergenic
1096671132 12:53198839-53198861 AGGGATACCAGACATATTGGTGG - Intronic
1097713544 12:62940148-62940170 GGAAACACCTGATTTATTGGGGG + Intergenic
1098236668 12:68424417-68424439 AGGAAGGCCTGATGTGTTGGAGG + Intergenic
1104724178 12:131065989-131066011 GGGGACACCTGATGTCTCTGTGG + Intronic
1105982568 13:25533941-25533963 ATGGACACAAGATGTGTTGGGGG + Intronic
1110743587 13:79026502-79026524 AGGGACCCCTGCTATAATGGAGG + Intergenic
1114083412 14:19220169-19220191 AGGGTCACCTGATGGAAGGGAGG - Intergenic
1120827600 14:88969684-88969706 AGGGACACCTTATCTACGGGTGG - Intergenic
1122299544 14:100724140-100724162 AGGGACACTTGAGGGATGGGAGG - Intergenic
1202895025 14_GL000194v1_random:1938-1960 AGGGTCACCTGATGGAAAGGAGG - Intergenic
1123449447 15:20350856-20350878 AGTGACACCTGGTGCGTTGGAGG + Intergenic
1128418266 15:67466594-67466616 GAGGGCACCTGATGTCTTGGGGG + Intronic
1129015098 15:72460394-72460416 AGGGAGACCTCATTTTTTGGGGG + Intergenic
1130696000 15:86132117-86132139 AGGGACTCCTGTTGTCTTGTGGG - Intergenic
1130939725 15:88497514-88497536 AGGGAGACCTGATGAAAGGGAGG - Intergenic
1132030777 15:98437142-98437164 AAGAACAGCTGATGTATTGATGG - Exonic
1132174337 15:99698165-99698187 AGAAAAAACTGATGTATTGGAGG + Intronic
1133217820 16:4304132-4304154 AGGGACATCTGCTGAATGGGCGG - Intergenic
1133828177 16:9297667-9297689 AGTGACACCTGGTGGCTTGGAGG - Intergenic
1134504185 16:14791906-14791928 AGGGGCAAATGATGTGTTGGGGG - Intronic
1134576388 16:15337002-15337024 AGGGGCAAATGATGTGTTGGGGG + Intergenic
1134726055 16:16419499-16419521 AGGGGCAAATGATGTGTTGGGGG - Intergenic
1134941378 16:18292361-18292383 AGGGGCAAATGATGTGTTGGGGG + Intergenic
1135204548 16:20472006-20472028 AGGGAAAGCTGGAGTATTGGAGG + Intronic
1135214340 16:20551805-20551827 AGGGAAAACTGGAGTATTGGAGG - Intronic
1135281434 16:21156779-21156801 AGGAACACATGATGTGATGGAGG + Intronic
1138169545 16:54836039-54836061 AGAGACACCTGTAGTATTAGTGG + Intergenic
1140329517 16:74040425-74040447 AGAGACACGTGATGTAATTGAGG - Intergenic
1142051235 16:87959640-87959662 AGGGACACATGGAGCATTGGAGG + Intronic
1144144616 17:12385083-12385105 AGGGACACCTAAAGAATAGGAGG - Intergenic
1147326878 17:39673855-39673877 CAGGACAGCTGATGTGTTGGGGG + Intronic
1149316395 17:55442847-55442869 AGTGACACCTTATGGAGTGGAGG - Intergenic
1149360714 17:55892645-55892667 AGAGATACCTGAGGTAATGGAGG - Intergenic
1149920009 17:60649100-60649122 AGTGACACCTCATCTCTTGGGGG - Intronic
1150941685 17:69699953-69699975 AGGGATAACTGATGCATGGGTGG - Intergenic
1152113127 17:78368354-78368376 GGGGAGACCTAATCTATTGGGGG + Intergenic
1152986075 18:322570-322592 AAGCACACCTGATTTATTCGTGG - Intronic
1158888925 18:61855379-61855401 AGGGACGCCAGCTGTAGTGGGGG + Intronic
1163374605 19:16922494-16922516 AGGGACCCCAGATGTAGTGTGGG - Intronic
926205984 2:10834661-10834683 AGGGACACTTGATGTGTTTGTGG + Intronic
930073737 2:47390154-47390176 AGGAAAATTTGATGTATTGGAGG - Intergenic
932182571 2:69661942-69661964 GGGGACACCAGATGTAGTCGAGG + Intronic
933575381 2:84061363-84061385 AGTGACACCTGATGGAATGCAGG - Intergenic
938493169 2:131776462-131776484 AGGGTCACCTGATGGAAGGGAGG + Intergenic
938499312 2:131822191-131822213 AGGGTCACCTGATGGAAGGGAGG - Intergenic
943169993 2:184386028-184386050 AAGGGCACCTGATGTCTTGAAGG + Intergenic
944610266 2:201396961-201396983 AGGGACAACTGTTGTATTTATGG + Intronic
945651634 2:212568503-212568525 AAGGACACATGATGTAGTGGGGG - Intergenic
947102219 2:226633372-226633394 ACGGTTACCTGATGTATAGGAGG + Intergenic
947256132 2:228165693-228165715 AAGGACACTTGATCTTTTGGGGG - Intronic
1171121601 20:22573246-22573268 AGGGACATCTGAAGTGTTAGGGG - Intergenic
1176614727 21:9017925-9017947 AGGGTCACCTGATGGAAAGGAGG - Intergenic
1176710482 21:10145946-10145968 AGGGTCACCTGATGGAAGGGAGG + Intergenic
1179400426 21:41077620-41077642 AGTGACATCTGAGGTACTGGAGG + Intergenic
1180294563 22:10873098-10873120 AGGGTCACCTGATGGAAGGGAGG + Intergenic
1180497369 22:15902512-15902534 AGGGTCACCTGATGGAAGGGAGG + Intergenic
1182130914 22:27849951-27849973 TGGGACACCTGATGCTTTGGTGG - Intergenic
1183559780 22:38563252-38563274 AGGTACAGCTGATGCAGTGGAGG + Intronic
1184969367 22:48004239-48004261 AGGCACACCTGCTGTGATGGTGG - Intergenic
950359592 3:12441026-12441048 AGGGACACCGGATGGATGGCTGG + Intergenic
950834111 3:15903014-15903036 AGGCACACCAAATGTATTGAGGG + Intergenic
950943522 3:16919739-16919761 GGGGACACCTGTTTTCTTGGAGG + Intronic
951174855 3:19587166-19587188 AGGGACACCTCTTGTATCAGGGG - Intergenic
957011958 3:75016476-75016498 AGGGGGACCTGAGGTATTGGGGG - Intergenic
958139721 3:89546637-89546659 AGGGACAGCAGAAGTATCGGTGG + Intergenic
966898177 3:184461410-184461432 AGGGACACCTGTTGCCTTGTAGG - Intronic
968656043 4:1778868-1778890 AGGGACACCTACCGTATTTGAGG + Intergenic
977166740 4:93709437-93709459 TGTGAAACCAGATGTATTGGAGG + Intronic
979324437 4:119362137-119362159 AGGTAGATTTGATGTATTGGTGG + Intergenic
979604458 4:122623044-122623066 TGAGACCCCTGATGTACTGGTGG - Intergenic
981091018 4:140732278-140732300 ATGGAGACTTGATGTCTTGGAGG - Intronic
984163723 4:176284126-176284148 AGGGATACATGATCTATTGGTGG + Intergenic
988121329 5:26966541-26966563 AGAGACACCTCATTTATTGTAGG - Intronic
988473138 5:31559122-31559144 AGTGGCACCTGAAGTATTGGTGG + Intergenic
992467032 5:77016154-77016176 AGGGACACCTGGGGTGATGGTGG + Intergenic
995083780 5:108084840-108084862 TGGGACACCTATTGTATTGATGG - Intronic
995408980 5:111833151-111833173 AGGGCTACGTGATGTATAGGTGG - Intronic
1000833096 5:166127792-166127814 AGGGTCACCTGCAGCATTGGTGG - Intergenic
1003304789 6:4916589-4916611 AGGGTGACCAGATGTATCGGGGG + Intronic
1004153704 6:13147503-13147525 ACGGAAACTTGAAGTATTGGGGG - Intronic
1008457828 6:51732345-51732367 AAGGAAACCTGAAGTATGGGGGG + Intronic
1014893137 6:126867488-126867510 AAAGAAACCTGATGCATTGGAGG - Intergenic
1017391824 6:153948251-153948273 AGAACCAACTGATGTATTGGAGG + Intergenic
1019862426 7:3672076-3672098 AGGGTCTCCTGAGGTCTTGGAGG + Intronic
1019907267 7:4074221-4074243 GGGGACAACTGAGGGATTGGGGG + Intronic
1020697806 7:11437094-11437116 AAGGACACAGGATCTATTGGAGG + Intronic
1021056988 7:16061238-16061260 GGGGACACGTGGTGTGTTGGAGG - Intergenic
1024005946 7:45224906-45224928 ATGGCCACCAGATGTCTTGGGGG + Intergenic
1028503094 7:91540816-91540838 AGGGTCACCTGAAGCCTTGGAGG - Intergenic
1034713894 7:153221453-153221475 AGGCACAGCTGATGCATTGTAGG + Intergenic
1036652366 8:10653432-10653454 GGAGACACCTGGTGTTTTGGAGG - Intronic
1036995621 8:13652606-13652628 AGAGACACTTTATGTATTGAGGG + Intergenic
1037470397 8:19202997-19203019 AGGGACACCTGAGGTTATGAAGG - Intergenic
1038485086 8:27929359-27929381 AGGGACACCTGATGTATTGGGGG - Intronic
1039857761 8:41431127-41431149 GGGGAGACCTGATGTAATTGGGG + Intergenic
1041902751 8:62999986-63000008 AGGGACCCCTTATGTATTGCTGG + Intergenic
1047819279 8:128500878-128500900 AGGGACACCTGAGGGAGAGGAGG + Intergenic
1048447144 8:134499898-134499920 GGGGACACCAGATGGATAGGAGG + Intronic
1050168129 9:2787777-2787799 AGGGACCCCTGAAGTATGGCTGG + Intronic
1050647398 9:7735280-7735302 AGGGACACCAAATGTTTTGATGG - Intergenic
1052355653 9:27502574-27502596 AGGGACACCTGATGTGTACTTGG - Intronic
1053575080 9:39351401-39351423 AGGGAGACCTGAGGAGTTGGGGG - Intergenic
1053620676 9:39811221-39811243 AGGTACAAATGATGTATTGTTGG - Intergenic
1053626034 9:39872714-39872736 AGGTACAAATGATGTATTGTTGG + Intergenic
1053647460 9:40131644-40131666 AGGGTCACCTGATGGAAGGGAGG + Intergenic
1053758267 9:41332199-41332221 AGGGTCACCTGATGGAAGGGAGG - Intergenic
1053839586 9:42179336-42179358 AGGGAGACCTGAGGAGTTGGGGG - Intergenic
1053878842 9:42570505-42570527 AGGTACAAATGATGTATTGCTGG - Intergenic
1053893825 9:42723860-42723882 AGGTACAAATGATGTATTGTTGG + Intergenic
1054096645 9:60910084-60910106 AGGGAGACCTGAGGAGTTGGGGG - Intergenic
1054118048 9:61185710-61185732 AGGGAGACCTGAGGAGTTGGGGG - Intergenic
1054217854 9:62377987-62378009 AGGTACAAATGATGTATTGTTGG - Intergenic
1054232847 9:62531190-62531212 AGGTACAAATGATGTATTGCTGG + Intergenic
1054263488 9:62896223-62896245 AGGTACAAATGATGTATTGTTGG + Intergenic
1054328442 9:63729598-63729620 AGGGTCACCTGATGGAAGGGAGG + Intergenic
1054537119 9:66244526-66244548 AGGGTCACCTGATGGAAGGGAGG - Intergenic
1054550825 9:66601052-66601074 AGGGACCCCAGATGTCTTTGAGG - Intergenic
1054589707 9:66996854-66996876 AGGGAGACCTGAGGAGTTGGGGG + Intergenic
1057950364 9:99364920-99364942 AGGTACACGTGATTTACTGGGGG + Intergenic
1060374324 9:123105147-123105169 AGGGACACTTGGTGTTTTTGAGG + Intergenic
1060433616 9:123572868-123572890 AGGGAATCCTCATGAATTGGGGG - Intronic
1060900226 9:127250526-127250548 AGGGGCACATGATATTTTGGGGG + Intronic
1202795245 9_KI270719v1_random:114941-114963 AGGGTCACCTGATGGAAGGGAGG + Intergenic
1185822521 X:3219248-3219270 AGGAGCACCTGATGTAGTTGAGG + Intergenic
1187317238 X:18207144-18207166 AGGGACACATGCAGTCTTGGGGG - Intronic
1190356353 X:49609228-49609250 AGGGACCCCTCATGTATTTGGGG - Intergenic
1192656794 X:73002118-73002140 AGGGACTGTTGATGTGTTGGAGG - Intergenic
1192665326 X:73080883-73080905 AGGGACTGTTGATGTGTTGGAGG + Intergenic
1192899780 X:75484145-75484167 GGGAACACCTGAAGTAATGGAGG + Intronic
1194141458 X:90215499-90215521 AGGGAAACTTTATGTATTGTTGG + Intergenic
1199973504 X:152877632-152877654 AGGGACTCCTGCTGAACTGGGGG + Intergenic