ID: 1038485087

View in Genome Browser
Species Human (GRCh38)
Location 8:27929360-27929382
Sequence TAGGGACACCTGATGTATTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 105
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 94}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1038485087_1038485093 -5 Left 1038485087 8:27929360-27929382 CCCCAATACATCAGGTGTCCCTA 0: 1
1: 0
2: 0
3: 10
4: 94
Right 1038485093 8:27929378-27929400 CCCTACAGTGCCAGCTGGGTAGG No data
1038485087_1038485100 20 Left 1038485087 8:27929360-27929382 CCCCAATACATCAGGTGTCCCTA 0: 1
1: 0
2: 0
3: 10
4: 94
Right 1038485100 8:27929403-27929425 CATGTGTATGGGAGGGAAGAAGG No data
1038485087_1038485101 29 Left 1038485087 8:27929360-27929382 CCCCAATACATCAGGTGTCCCTA 0: 1
1: 0
2: 0
3: 10
4: 94
Right 1038485101 8:27929412-27929434 GGGAGGGAAGAAGGAAGCTAAGG No data
1038485087_1038485091 -9 Left 1038485087 8:27929360-27929382 CCCCAATACATCAGGTGTCCCTA 0: 1
1: 0
2: 0
3: 10
4: 94
Right 1038485091 8:27929374-27929396 GTGTCCCTACAGTGCCAGCTGGG No data
1038485087_1038485102 30 Left 1038485087 8:27929360-27929382 CCCCAATACATCAGGTGTCCCTA 0: 1
1: 0
2: 0
3: 10
4: 94
Right 1038485102 8:27929413-27929435 GGAGGGAAGAAGGAAGCTAAGGG No data
1038485087_1038485090 -10 Left 1038485087 8:27929360-27929382 CCCCAATACATCAGGTGTCCCTA 0: 1
1: 0
2: 0
3: 10
4: 94
Right 1038485090 8:27929373-27929395 GGTGTCCCTACAGTGCCAGCTGG No data
1038485087_1038485096 8 Left 1038485087 8:27929360-27929382 CCCCAATACATCAGGTGTCCCTA 0: 1
1: 0
2: 0
3: 10
4: 94
Right 1038485096 8:27929391-27929413 GCTGGGTAGGTACATGTGTATGG No data
1038485087_1038485097 9 Left 1038485087 8:27929360-27929382 CCCCAATACATCAGGTGTCCCTA 0: 1
1: 0
2: 0
3: 10
4: 94
Right 1038485097 8:27929392-27929414 CTGGGTAGGTACATGTGTATGGG No data
1038485087_1038485099 13 Left 1038485087 8:27929360-27929382 CCCCAATACATCAGGTGTCCCTA 0: 1
1: 0
2: 0
3: 10
4: 94
Right 1038485099 8:27929396-27929418 GTAGGTACATGTGTATGGGAGGG No data
1038485087_1038485098 12 Left 1038485087 8:27929360-27929382 CCCCAATACATCAGGTGTCCCTA 0: 1
1: 0
2: 0
3: 10
4: 94
Right 1038485098 8:27929395-27929417 GGTAGGTACATGTGTATGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1038485087 Original CRISPR TAGGGACACCTGATGTATTG GGG (reversed) Intronic
907295536 1:53450000-53450022 TAGGGACACGTGATTTTTAGTGG - Intergenic
909934216 1:81532288-81532310 TAGGGTAACCTTATTTATTGGGG - Intronic
909992412 1:82239705-82239727 GAGGGACAGCTGCAGTATTGTGG - Intergenic
910534617 1:88283154-88283176 TATGTACATATGATGTATTGGGG - Intergenic
912545966 1:110452027-110452049 TAGGGGCACATGATGTGTTATGG + Intronic
915194061 1:154176087-154176109 TAGGGAAGCCTGATGGAGTGTGG - Intronic
917502271 1:175596444-175596466 TTGAGACACCTGCTGTACTGTGG + Intronic
918316035 1:183323429-183323451 TAGGGTCACTTGAAGTATGGTGG - Intronic
918407343 1:184223960-184223982 GAAGGACACCTGATTTATTTTGG + Intergenic
918730272 1:187984488-187984510 TAGGGAAAAGTGATGTATAGGGG - Intergenic
1062896579 10:1107685-1107707 TAGGTTCACCTGTTGTATTGCGG + Intronic
1063843274 10:10096054-10096076 CAGGAAGACCTGATGTACTGTGG + Intergenic
1063891353 10:10632030-10632052 TAGGGACACCTGCTGTGTGCTGG - Intergenic
1065135880 10:22669612-22669634 TATGGACACCGGGTTTATTGCGG + Intronic
1065484261 10:26221884-26221906 CAGGGACACCTGACCTATGGGGG + Intronic
1065926872 10:30442418-30442440 CATGGAGACCTGATGTATTCAGG + Intronic
1072438102 10:95431788-95431810 TTGGGAAACCTGAGGTATTGAGG - Intronic
1074394899 10:113089519-113089541 TGGGGAGCCCTGGTGTATTGAGG + Intronic
1081097040 11:38949643-38949665 TAGGGACATTTGAAGTATTATGG + Intergenic
1086027238 11:82308603-82308625 GAGAGACACCTGATATACTGGGG + Intergenic
1089339508 11:117747973-117747995 AAGGGAAACCTGTTGTGTTGGGG - Intronic
1090191431 11:124772211-124772233 GAGGGACACCTGAAGTATTTTGG - Intronic
1090780991 11:130006360-130006382 TATGGACACCAGATATATTTTGG + Intergenic
1091570860 12:1684203-1684225 TAGCCACACCTGAGGTATTGCGG - Intergenic
1097713543 12:62940147-62940169 TGGAAACACCTGATTTATTGGGG + Intergenic
1098315026 12:69183916-69183938 TAGGGACATTTGTTGGATTGAGG + Intergenic
1106316663 13:28600302-28600324 CAGGGAGATGTGATGTATTGAGG - Intergenic
1107734074 13:43377578-43377600 TTGGGACTCCAGATGAATTGTGG + Intronic
1110794406 13:79620150-79620172 TAGGATCAACTGATGTTTTGGGG - Intergenic
1112584677 13:100707900-100707922 GAGAGACACCTGAGGTTTTGAGG - Intergenic
1114875685 14:26715170-26715192 TTTGGACACCTGGTATATTGGGG - Intergenic
1121258192 14:92546833-92546855 CAGGGACACCTGTTGCTTTGGGG - Intronic
1121800420 14:96769711-96769733 TAAGGACACCTGTCATATTGAGG + Intergenic
1129015097 15:72460393-72460415 TAGGGAGACCTCATTTTTTGGGG + Intergenic
1130696001 15:86132118-86132140 CAGGGACTCCTGTTGTCTTGTGG - Intergenic
1132735570 16:1384241-1384263 TGGGGACACCTGCCGTGTTGGGG - Intronic
1134426230 16:14148819-14148841 TAAGAACACATGATGTAATGAGG - Intronic
1137903939 16:52300150-52300172 CAGGGACACCTGATATTTCGTGG - Intergenic
1138246166 16:55468642-55468664 TAGGGACACCTGCTTTCTTGAGG + Intronic
1140244476 16:73235569-73235591 TCTGGTCACCTGATGTATGGGGG + Intergenic
1140733710 16:77879234-77879256 CAGGCACATCTGATGTACTGTGG + Intronic
1142837868 17:2602340-2602362 TAGTGACATTTGATGTCTTGGGG - Intronic
1143512041 17:7401955-7401977 CAGGGACAGATCATGTATTGGGG - Intronic
1146524361 17:33553362-33553384 TTGTGACACCTGTTGTCTTGGGG - Intronic
1147303725 17:39549252-39549274 TAGGGACACCGTAAGTATGGAGG + Intronic
1149286493 17:55171216-55171238 GAGGCACACCTGATGTTTTGTGG - Intergenic
1149920010 17:60649101-60649123 TAGTGACACCTCATCTCTTGGGG - Intronic
1152113126 17:78368353-78368375 TGGGGAGACCTAATCTATTGGGG + Intergenic
1157709414 18:49839632-49839654 TAGGGGGACCTGATATATTGAGG - Intronic
1160376111 18:78413931-78413953 TGGGGACACCTCATGGATTTTGG - Intergenic
1163374606 19:16922495-16922517 CAGGGACCCCAGATGTAGTGTGG - Intronic
1165749685 19:38252319-38252341 TAGGGACTCCTGAAGTCATGTGG - Exonic
929560219 2:42951920-42951942 TAGGGACACGTGATGGCTTCAGG - Intergenic
931372820 2:61679860-61679882 TAGGAACACTTGATTTAGTGGGG + Intergenic
940976613 2:159952860-159952882 TATGTACAGCTGCTGTATTGAGG - Intronic
942530412 2:176903874-176903896 TAGGAACACCTAATATTTTGTGG + Intergenic
945651635 2:212568504-212568526 CAAGGACACATGATGTAGTGGGG - Intergenic
948255396 2:236564622-236564644 CAGGGACAACTGATTTATTAAGG - Intergenic
1169294256 20:4379256-4379278 TAAGGACACCTGTTCTATTGGGG + Intergenic
1170772820 20:19348922-19348944 AAGGGAAACCTGAAGTATTCAGG - Intronic
1171121602 20:22573247-22573269 TAGGGACATCTGAAGTGTTAGGG - Intergenic
1173764531 20:45595628-45595650 GAGGGACAGCTGTGGTATTGTGG - Intergenic
1178297332 21:31421340-31421362 TAGGGACCCCTGCTCTATGGAGG - Intronic
1180130688 21:45825081-45825103 CAGGGACACCTGCTGTATGCAGG - Intronic
1181503349 22:23332966-23332988 TCAGGACACCTGATGAGTTGAGG + Intergenic
1181708341 22:24663175-24663197 TCAGGACACCTGATGAGTTGAGG + Intergenic
1181903975 22:26178499-26178521 TAGGGACTGGTGATGTTTTGGGG + Intronic
949564247 3:5230370-5230392 TGGGGACCCCTGATCTAGTGGGG - Intergenic
950834110 3:15903013-15903035 CAGGCACACCAAATGTATTGAGG + Intergenic
951096107 3:18633234-18633256 TAGGGCCACCTGCTGTAAAGCGG - Intergenic
953517075 3:43604325-43604347 TAGGGACACTGGATCTATGGAGG - Intronic
954646818 3:52136646-52136668 AAGGGACAGCTGATGGTTTGGGG - Intronic
957011959 3:75016477-75016499 AAGGGGGACCTGAGGTATTGGGG - Intergenic
963695866 3:148565491-148565513 GAGGGACAATTGTTGTATTGTGG + Intergenic
979466590 4:121045942-121045964 TAGGGACGCATCATGTATTTTGG + Intronic
979935001 4:126682262-126682284 CAGAGAAAACTGATGTATTGAGG + Intergenic
987940533 5:24530230-24530252 AAGGGACATCTAATGTACTGAGG - Intronic
998146514 5:139732064-139732086 CAGTGACACCTGATGGATTTAGG + Intergenic
999952267 5:156663799-156663821 GAGGGACAATTGTTGTATTGTGG + Intronic
1001741008 5:174052662-174052684 TGGGGACACCTGGGTTATTGTGG - Intronic
1005398284 6:25406191-25406213 TAGGGAGACCTGGTGTAGTCTGG + Intronic
1008913040 6:56757268-56757290 TAGGGACATCTGATGTTTACTGG - Intronic
1015439635 6:133233213-133233235 TAGGGTTGCCTGATGCATTGAGG - Intergenic
1018576454 6:165264751-165264773 TAGGGAGACTTGAAGCATTGAGG + Intergenic
1019907266 7:4074220-4074242 TGGGGACAACTGAGGGATTGGGG + Intronic
1026513149 7:71044222-71044244 TAGGGGCATCTGCTGTATGGCGG + Intergenic
1029068214 7:97873106-97873128 TAAGGACCACTGATGTATTTTGG - Intergenic
1034590743 7:152137034-152137056 AAGGAAGACCTGATTTATTGAGG + Intronic
1036995620 8:13652605-13652627 TAGAGACACTTTATGTATTGAGG + Intergenic
1038485087 8:27929360-27929382 TAGGGACACCTGATGTATTGGGG - Intronic
1039833864 8:41239864-41239886 AAGAGACACATTATGTATTGGGG - Intergenic
1039857760 8:41431126-41431148 TGGGGAGACCTGATGTAATTGGG + Intergenic
1040037389 8:42883882-42883904 GAGGGAATCATGATGTATTGGGG - Intronic
1042791302 8:72609011-72609033 TAGGCACAAGTGATGTAGTGGGG + Intronic
1042807681 8:72789647-72789669 CAGGGTCCCCTGATGTCTTGAGG - Intronic
1048876454 8:138840131-138840153 TAGGGACAGCTTCTGTATTCTGG - Intronic
1056829607 9:89904696-89904718 TAAGGACACATGATATAGTGTGG + Intergenic
1057950363 9:99364919-99364941 TAGGTACACGTGATTTACTGGGG + Intergenic
1058173820 9:101714603-101714625 TTTGGCCACCTGATGTATAGGGG + Intronic
1060900225 9:127250525-127250547 TAGGGGCACATGATATTTTGGGG + Intronic
1188531779 X:31149252-31149274 TATGGACACTTGATGTTTTGCGG - Intronic
1190356354 X:49609229-49609251 AAGGGACCCCTCATGTATTTGGG - Intergenic
1193336581 X:80296851-80296873 TATGGACAGTTCATGTATTGTGG + Intergenic
1193743643 X:85247853-85247875 TAGGGACACTTGAAATATGGTGG + Intronic
1201734108 Y:17238673-17238695 TAGGTACTCCTGATGGGTTGGGG - Intergenic