ID: 1038485088

View in Genome Browser
Species Human (GRCh38)
Location 8:27929361-27929383
Sequence GTAGGGACACCTGATGTATT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 81
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 74}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1038485088_1038485093 -6 Left 1038485088 8:27929361-27929383 CCCAATACATCAGGTGTCCCTAC 0: 1
1: 0
2: 0
3: 6
4: 74
Right 1038485093 8:27929378-27929400 CCCTACAGTGCCAGCTGGGTAGG No data
1038485088_1038485098 11 Left 1038485088 8:27929361-27929383 CCCAATACATCAGGTGTCCCTAC 0: 1
1: 0
2: 0
3: 6
4: 74
Right 1038485098 8:27929395-27929417 GGTAGGTACATGTGTATGGGAGG No data
1038485088_1038485091 -10 Left 1038485088 8:27929361-27929383 CCCAATACATCAGGTGTCCCTAC 0: 1
1: 0
2: 0
3: 6
4: 74
Right 1038485091 8:27929374-27929396 GTGTCCCTACAGTGCCAGCTGGG No data
1038485088_1038485101 28 Left 1038485088 8:27929361-27929383 CCCAATACATCAGGTGTCCCTAC 0: 1
1: 0
2: 0
3: 6
4: 74
Right 1038485101 8:27929412-27929434 GGGAGGGAAGAAGGAAGCTAAGG No data
1038485088_1038485100 19 Left 1038485088 8:27929361-27929383 CCCAATACATCAGGTGTCCCTAC 0: 1
1: 0
2: 0
3: 6
4: 74
Right 1038485100 8:27929403-27929425 CATGTGTATGGGAGGGAAGAAGG No data
1038485088_1038485096 7 Left 1038485088 8:27929361-27929383 CCCAATACATCAGGTGTCCCTAC 0: 1
1: 0
2: 0
3: 6
4: 74
Right 1038485096 8:27929391-27929413 GCTGGGTAGGTACATGTGTATGG No data
1038485088_1038485102 29 Left 1038485088 8:27929361-27929383 CCCAATACATCAGGTGTCCCTAC 0: 1
1: 0
2: 0
3: 6
4: 74
Right 1038485102 8:27929413-27929435 GGAGGGAAGAAGGAAGCTAAGGG No data
1038485088_1038485099 12 Left 1038485088 8:27929361-27929383 CCCAATACATCAGGTGTCCCTAC 0: 1
1: 0
2: 0
3: 6
4: 74
Right 1038485099 8:27929396-27929418 GTAGGTACATGTGTATGGGAGGG No data
1038485088_1038485097 8 Left 1038485088 8:27929361-27929383 CCCAATACATCAGGTGTCCCTAC 0: 1
1: 0
2: 0
3: 6
4: 74
Right 1038485097 8:27929392-27929414 CTGGGTAGGTACATGTGTATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1038485088 Original CRISPR GTAGGGACACCTGATGTATT GGG (reversed) Intronic
903749500 1:25612012-25612034 GAAGTGACACCGGATGAATTAGG - Intergenic
911574326 1:99557098-99557120 GTAGGGACACATTCTGTATATGG - Intergenic
912467994 1:109887127-109887149 TTTGGGACACCTGATGTAAGGGG - Intergenic
923070295 1:230558259-230558281 GTAAGGACACCAGTTGTGTTGGG + Intergenic
1065484260 10:26221883-26221905 GCAGGGACACCTGACCTATGGGG + Intronic
1074118022 10:110472227-110472249 GTAGGTGCTCCTGCTGTATTAGG - Intergenic
1074219526 10:111422676-111422698 GAAGAGGCACTTGATGTATTTGG + Intergenic
1077841142 11:5976086-5976108 GTAGAGATACCTGTTGTCTTGGG + Intergenic
1077945947 11:6898798-6898820 GAAGGGATAACTGATATATTGGG - Intergenic
1080310121 11:30880322-30880344 GTAGGGAGACGGGATTTATTAGG - Intronic
1084106055 11:66981296-66981318 GTAAGGACAACTGTTGTATTGGG + Intergenic
1086729139 11:90226925-90226947 TAAGGGATACCAGATGTATTAGG + Intergenic
1089339509 11:117747974-117747996 GAAGGGAAACCTGTTGTGTTGGG - Intronic
1094819758 12:34215413-34215435 CTAGTGAGACCAGATGTATTAGG - Intergenic
1101966057 12:109282796-109282818 GTAGGGTCCCCAGATCTATTTGG + Intronic
1103982344 12:124744803-124744825 GGAGGGTCACATGATGTAGTCGG - Intergenic
1106519962 13:30488165-30488187 GTATGACCACCTGGTGTATTTGG - Intronic
1110794407 13:79620151-79620173 GTAGGATCAACTGATGTTTTGGG - Intergenic
1113076606 13:106473352-106473374 GCAGGGACACCTGATGCACGAGG - Intergenic
1126231787 15:46335377-46335399 GTTGGGAAACGTGATGTCTTTGG + Intergenic
1132735571 16:1384242-1384264 GTGGGGACACCTGCCGTGTTGGG - Intronic
1134521314 16:14920324-14920346 GTAGGGACCCCTGATGCCTCTGG + Intronic
1134708989 16:16318975-16318997 GTAGGGACCCCTGATGCCTCTGG + Intergenic
1134950616 16:18349670-18349692 GTAGGGACCCCTGATGCCTCTGG - Intergenic
1143512042 17:7401956-7401978 GCAGGGACAGATCATGTATTGGG - Intronic
1143626112 17:8110994-8111016 GTAGGGCCACCAGATGCATCAGG - Intronic
1146524362 17:33553363-33553385 GTTGTGACACCTGTTGTCTTGGG - Intronic
1153974254 18:10253495-10253517 CTAGGGACAGCTGATGTCTGTGG + Intergenic
1156649169 18:39203831-39203853 GCAGAGAAACCTGATGCATTTGG - Intergenic
1158285314 18:55874182-55874204 TTAGGGACCCCTGTTGTTTTAGG + Intergenic
1165829126 19:38721884-38721906 GGTGGGACACCTGAAGGATTTGG + Intronic
928330503 2:30354606-30354628 GAAGGGACCCCAGATGCATTGGG + Intergenic
932064499 2:68539477-68539499 GTAAGGACACCAGTTATATTAGG + Intronic
940312318 2:152291843-152291865 TTGGGGACCCCTGATCTATTTGG - Intergenic
941013116 2:160323500-160323522 ATAGGGACATATGATGTACTAGG + Intronic
1169294255 20:4379255-4379277 ATAAGGACACCTGTTCTATTGGG + Intergenic
1171121603 20:22573248-22573270 GTAGGGACATCTGAAGTGTTAGG - Intergenic
1179587781 21:42384651-42384673 GGAGGGACAGCTCATGTGTTGGG - Intronic
1179944027 21:44658510-44658532 ATAGGGACAGCCGATTTATTTGG - Intronic
1181883498 22:26000111-26000133 GAATGGACACCTTATGTGTTGGG + Intronic
1181903974 22:26178498-26178520 GTAGGGACTGGTGATGTTTTGGG + Intronic
1182058408 22:27379193-27379215 ATAGGGACATCTGCTGCATTTGG + Intergenic
1182298799 22:29326804-29326826 GCAGGGACTCCAGATGCATTTGG + Intergenic
952766508 3:36958701-36958723 GTAGGGACAACTGAGGTGGTGGG + Intergenic
957562470 3:81840245-81840267 GTTGGGAAACCCTATGTATTTGG + Intergenic
959120247 3:102223821-102223843 GGAGAGTCACCTAATGTATTTGG + Intronic
959562312 3:107796500-107796522 GAAGGGACAGCTGATGGATCTGG + Intronic
963059399 3:141212672-141212694 GTAGGGACAGCTGAGGTATAAGG + Intergenic
964489110 3:157216002-157216024 ATAGGGACATCTGATATACTTGG - Intergenic
965884958 3:173433754-173433776 GATGGGACAACTGATGTTTTAGG - Intronic
972101548 4:35426134-35426156 GTAAGGACACCTCATGATTTTGG + Intergenic
976652532 4:87451396-87451418 ATAAGGATACCTCATGTATTTGG - Intronic
978316165 4:107439802-107439824 TTGGGGACCCCTGATCTATTGGG + Intergenic
981569019 4:146132064-146132086 ATAGGGACACCGGTTGTACTGGG - Intergenic
983710250 4:170706380-170706402 GTAGGGAGACCTGAGTGATTGGG + Intergenic
985486480 5:154449-154471 GTTGGGGCACCTGATGCATGCGG - Intronic
988504819 5:31812647-31812669 GTAGGCTCACCTGATGAAGTGGG + Intronic
994499146 5:100552064-100552086 GAAGTGACAACTGATGGATTGGG + Intronic
995012554 5:107274274-107274296 GTAGGGACACCAGTTATATTGGG - Intergenic
995014673 5:107296559-107296581 GTAGTGAAACCTCATGTATTTGG + Intergenic
995281263 5:110338385-110338407 GTAGGGACTGCTGATTGATTGGG + Intronic
997288713 5:132707096-132707118 GTTGGGAAATCGGATGTATTGGG - Intronic
1001006078 5:168051573-168051595 GTAGGAAGAAGTGATGTATTGGG - Intronic
1001891244 5:175340966-175340988 GTAGCAAGACCCGATGTATTAGG + Intergenic
1007398880 6:41592400-41592422 GTTGGGACAGCTGCTGTAATTGG + Intronic
1011167485 6:84465318-84465340 TTAGAGACATCTGATTTATTTGG - Intergenic
1011720854 6:90155170-90155192 GTGGAGAAACCTGATGTTTTGGG - Intronic
1012728459 6:102847373-102847395 ATAGTGACACCTGATTTTTTGGG - Intergenic
1019907265 7:4074219-4074241 GTGGGGACAACTGAGGGATTGGG + Intronic
1023645233 7:42305453-42305475 GTATGGATATCTGATGTATTTGG + Intergenic
1027654588 7:80915050-80915072 GTAGAGACATCTAATCTATTAGG + Intronic
1028437472 7:90821298-90821320 GTAGGATCACCTGAGGTTTTAGG - Intronic
1036950445 8:13134137-13134159 TTGAGGACCCCTGATGTATTAGG + Intronic
1038485088 8:27929361-27929383 GTAGGGACACCTGATGTATTGGG - Intronic
1039857759 8:41431125-41431147 TTGGGGAGACCTGATGTAATTGG + Intergenic
1045340727 8:101252269-101252291 ATAGGGACACCAGTTATATTTGG + Intergenic
1047042140 8:121007832-121007854 GTGGGGCCAGCTGATGCATTGGG + Intergenic
1047693154 8:127377109-127377131 ATAAGGACACCAGTTGTATTGGG - Intergenic
1050851787 9:10296695-10296717 GAAGGGACACCTCAGGTATCTGG + Intronic
1062643221 9:137532849-137532871 GTAGCCACACCTGATGTCCTTGG - Intronic
1190356355 X:49609230-49609252 CAAGGGACCCCTCATGTATTTGG - Intergenic