ID: 1038485089

View in Genome Browser
Species Human (GRCh38)
Location 8:27929362-27929384
Sequence TGTAGGGACACCTGATGTAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 138
Summary {0: 1, 1: 0, 2: 2, 3: 16, 4: 119}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1038485089_1038485099 11 Left 1038485089 8:27929362-27929384 CCAATACATCAGGTGTCCCTACA 0: 1
1: 0
2: 2
3: 16
4: 119
Right 1038485099 8:27929396-27929418 GTAGGTACATGTGTATGGGAGGG No data
1038485089_1038485097 7 Left 1038485089 8:27929362-27929384 CCAATACATCAGGTGTCCCTACA 0: 1
1: 0
2: 2
3: 16
4: 119
Right 1038485097 8:27929392-27929414 CTGGGTAGGTACATGTGTATGGG No data
1038485089_1038485100 18 Left 1038485089 8:27929362-27929384 CCAATACATCAGGTGTCCCTACA 0: 1
1: 0
2: 2
3: 16
4: 119
Right 1038485100 8:27929403-27929425 CATGTGTATGGGAGGGAAGAAGG No data
1038485089_1038485102 28 Left 1038485089 8:27929362-27929384 CCAATACATCAGGTGTCCCTACA 0: 1
1: 0
2: 2
3: 16
4: 119
Right 1038485102 8:27929413-27929435 GGAGGGAAGAAGGAAGCTAAGGG No data
1038485089_1038485096 6 Left 1038485089 8:27929362-27929384 CCAATACATCAGGTGTCCCTACA 0: 1
1: 0
2: 2
3: 16
4: 119
Right 1038485096 8:27929391-27929413 GCTGGGTAGGTACATGTGTATGG No data
1038485089_1038485093 -7 Left 1038485089 8:27929362-27929384 CCAATACATCAGGTGTCCCTACA 0: 1
1: 0
2: 2
3: 16
4: 119
Right 1038485093 8:27929378-27929400 CCCTACAGTGCCAGCTGGGTAGG No data
1038485089_1038485098 10 Left 1038485089 8:27929362-27929384 CCAATACATCAGGTGTCCCTACA 0: 1
1: 0
2: 2
3: 16
4: 119
Right 1038485098 8:27929395-27929417 GGTAGGTACATGTGTATGGGAGG No data
1038485089_1038485101 27 Left 1038485089 8:27929362-27929384 CCAATACATCAGGTGTCCCTACA 0: 1
1: 0
2: 2
3: 16
4: 119
Right 1038485101 8:27929412-27929434 GGGAGGGAAGAAGGAAGCTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1038485089 Original CRISPR TGTAGGGACACCTGATGTAT TGG (reversed) Intronic
901856091 1:12045038-12045060 TGTAAGGACACCAGTCGTATTGG - Intergenic
902167614 1:14585005-14585027 TGTAAGGACACCAGTTGTGTTGG - Intergenic
902221207 1:14967038-14967060 GGAAGGGACACCTGATGTTGAGG + Intronic
908055095 1:60277468-60277490 TATAAGGACACCTGTTCTATTGG + Intergenic
912149306 1:106837585-106837607 TGTAGGGACAGAGGATATATGGG + Intergenic
912467995 1:109887128-109887150 CTTTGGGACACCTGATGTAAGGG - Intergenic
912564562 1:110577355-110577377 TGTAGGTGCACCATATGTATTGG + Intergenic
915576002 1:156777721-156777743 TGTAGGGACACCTAGTGAAAAGG + Intronic
915637777 1:157198535-157198557 TATAAGGACACCAGGTGTATTGG - Intergenic
917445065 1:175099892-175099914 TGGGGGAACCCCTGATGTATTGG - Intronic
917472268 1:175336019-175336041 TGTAGAGGCCCCTGATGAATAGG + Intronic
919742525 1:200989514-200989536 TCGAGGGACACCTGATGTTCTGG + Intronic
923070294 1:230558258-230558280 TGTAAGGACACCAGTTGTGTTGG + Intergenic
1062917685 10:1254279-1254301 TGGAGGGCCTCCTGTTGTATGGG + Intronic
1064305322 10:14160492-14160514 TGGAGAGACACCTGTTGAATGGG + Intronic
1065484259 10:26221882-26221904 TGCAGGGACACCTGACCTATGGG + Intronic
1065889670 10:30110245-30110267 TGTATGGACCCCTGAGGTATGGG + Intronic
1065889800 10:30111115-30111137 TGTATGGACCCCTGATGTATGGG + Intronic
1067518130 10:46972878-46972900 TATAAGGACATCTGATGGATTGG - Intronic
1067644119 10:48078950-48078972 TATAAGGACATCTGATGGATTGG + Intergenic
1070842685 10:79498546-79498568 TGTGGGGACCCCTGCTGTAAAGG - Intergenic
1071785869 10:88899263-88899285 TGTTTGGAAACCTCATGTATTGG + Intronic
1076467895 10:130697576-130697598 TGGAGGGAGACCCGATGTCTGGG + Intergenic
1077615362 11:3670102-3670124 TGCAGGGACACATGAGGTAAAGG + Intronic
1078576828 11:12509767-12509789 TGAAGGGTCAACTGATCTATAGG + Intronic
1080942245 11:36932229-36932251 TGTAGGGAGTCCTGATATGTGGG + Intergenic
1084106054 11:66981295-66981317 TGTAAGGACAACTGTTGTATTGG + Intergenic
1087462480 11:98462832-98462854 TGCAGGGGCACCTGCTGCATGGG + Intergenic
1089166937 11:116484586-116484608 TGTAAGGACACCTATCGTATTGG - Intergenic
1091939198 12:4461059-4461081 TGTAGGAACAGGTGATATATGGG + Intergenic
1092044910 12:5424496-5424518 TGTAAGGACTCATGATATATAGG - Intergenic
1097651787 12:62307532-62307554 TGTAGTGCCTCTTGATGTATAGG - Intronic
1101618706 12:106362632-106362654 TATAAGGACACCAGTTGTATTGG + Intronic
1101805154 12:108057101-108057123 TATAAGGACACCAGTTGTATTGG + Intergenic
1102188623 12:110968971-110968993 TATAAGGACACCCGTTGTATTGG - Intergenic
1102806478 12:115785648-115785670 TGTAAGGACACCAGTTGCATTGG - Intergenic
1107627061 13:42299143-42299165 TCTAGGGATACCTGGTCTATGGG - Intronic
1113408188 13:110061349-110061371 TGGAGGGCCACCTGATGAACTGG - Intergenic
1114083413 14:19220172-19220194 GGTAGGGTCACCTGATGGAAGGG - Intergenic
1118674867 14:68172929-68172951 TGTAGGGACACCTGGATTACAGG + Intronic
1122299545 14:100724143-100724165 TGCAGGGACACTTGAGGGATGGG - Intergenic
1135087439 16:19486692-19486714 TTTAGGGACACCGGTTGTACTGG + Intronic
1138731005 16:59195196-59195218 TGGAAGGACATCTGATGTTTGGG + Intergenic
1141535678 16:84678113-84678135 TGTAAGGACACCGGTTGTATTGG + Intergenic
1143306076 17:5947741-5947763 TGTGGACACACCTGATGTCTTGG - Intronic
1143364655 17:6398449-6398471 TATAAGGACACCAGTTGTATTGG - Intronic
1144047905 17:11469959-11469981 TGTATGGACACCAGTTCTATAGG - Intronic
1144836792 17:18160726-18160748 TGTAGGGATATCTGGTGTCTGGG - Intronic
1147276645 17:39323303-39323325 TTTAGGGACACCTAATGACTTGG - Intronic
1150578566 17:66452120-66452142 TGGAGGGTCACCTGATGTCTTGG - Intronic
1150976530 17:70093444-70093466 TGTAAGGACACCAGTCGTATTGG + Intronic
1155593021 18:27449813-27449835 TGTAGGGACAGCCAGTGTATGGG - Intergenic
1159136973 18:64347859-64347881 TGTAGGGACACCTGTTGTCTGGG + Intergenic
925629771 2:5879668-5879690 AGTAGGGACATCTGATTGATTGG - Intergenic
925849490 2:8067194-8067216 TATAGTGACACCAGTTGTATTGG - Intergenic
926635268 2:15171777-15171799 TGTAAGGACACCGGTTATATCGG - Intronic
926715349 2:15919831-15919853 TGTAAGGACACCTGTCATATTGG + Intergenic
931548995 2:63421874-63421896 TGTAGGGACACGGGATGAATAGG - Intronic
931889173 2:66651172-66651194 TGTAGGGACACCAGTGATATTGG + Intergenic
934102236 2:88664244-88664266 TGTTATGACACCTGGTGTATTGG - Intergenic
944296000 2:198063029-198063051 TGTGGGGACCACTGATGTAGTGG + Intronic
944667214 2:201968101-201968123 TATAAGGACACCAGTTGTATTGG - Intergenic
945228690 2:207560509-207560531 TGTATAGTCACCTTATGTATAGG + Intronic
947055681 2:226099279-226099301 TATAAGGACACCAGATGTATTGG + Intergenic
948173816 2:235928015-235928037 TGCAGGGACACCTGCTGTGTAGG - Intronic
1169294254 20:4379254-4379276 TATAAGGACACCTGTTCTATTGG + Intergenic
1171203857 20:23264325-23264347 AGTAAGAACACCTGTTGTATTGG + Intergenic
1173747591 20:45449707-45449729 TTTAAGGACACCAGTTGTATTGG + Intergenic
1176710481 21:10145943-10145965 GGTAGGGTCACCTGATGGAAGGG + Intergenic
1177225420 21:18246334-18246356 TCTAGTGACACCTGTTGTATAGG - Intronic
1178828149 21:36033009-36033031 TGTAGGGGCCGCTGATGTGTGGG + Intergenic
1179587782 21:42384652-42384674 TGGAGGGACAGCTCATGTGTTGG - Intronic
1179894856 21:44355812-44355834 CGGAGGGACAGCTGTTGTATTGG - Intronic
1180294562 22:10873095-10873117 GGTAGGGTCACCTGATGGAAGGG + Intergenic
1180497368 22:15902509-15902531 GGTAGGGTCACCTGATGGAAGGG + Intergenic
1181168999 22:20997873-20997895 AGTGGGGACCCATGATGTATGGG + Exonic
1181883497 22:26000110-26000132 TGAATGGACACCTTATGTGTTGG + Intronic
1181907113 22:26207311-26207333 TGCAGGGAGACCTCATATATTGG + Intronic
1183460468 22:37946959-37946981 TGTAGTGGCAACTTATGTATAGG + Intronic
1185098839 22:48826714-48826736 TGCAGGGGCACCTGATCAATGGG - Intronic
951940798 3:28076687-28076709 TGTAGAGACACCACATGTAGAGG + Intergenic
952766507 3:36958700-36958722 TGTAGGGACAACTGAGGTGGTGG + Intergenic
956927391 3:74003867-74003889 TATAAGGACACCAGGTGTATTGG - Intergenic
962607972 3:137048521-137048543 TGTAAGGACACCTGTGATATTGG - Intergenic
963829253 3:149989742-149989764 TGTAAGGACACCTGTTATATTGG + Intronic
967652072 3:191998164-191998186 TGCAGGGAAACCTGATGCCTGGG + Intergenic
970233778 4:13938191-13938213 TGTAGGGGTCCCTGATGTATGGG + Intergenic
973967808 4:56181811-56181833 TATAAGGACACCAGATATATTGG + Intronic
976373382 4:84316020-84316042 GGTAGGGACACCAGATATACAGG - Intergenic
979852535 4:125591598-125591620 TTTGGGGACTCCTGCTGTATAGG + Intergenic
981569020 4:146132065-146132087 TATAGGGACACCGGTTGTACTGG - Intergenic
982089344 4:151866970-151866992 TAAAGGAACACCAGATGTATTGG + Intergenic
982116705 4:152104228-152104250 TATAAGGACACCAGTTGTATTGG - Intergenic
983710249 4:170706379-170706401 TGTAGGGAGACCTGAGTGATTGG + Intergenic
986315726 5:6585140-6585162 TGTAGGGACACCAGTCATATGGG - Intergenic
986661610 5:10064927-10064949 TGGAAGGACACCAGATGTACTGG - Intergenic
987607299 5:20153776-20153798 TATAGGGACACCAGTTTTATTGG + Intronic
988411312 5:30889233-30889255 TCTAAGGACACCAGTTGTATTGG + Intergenic
988504818 5:31812646-31812668 TGTAGGCTCACCTGATGAAGTGG + Intronic
990491240 5:56305004-56305026 TGTGGGGACACCGGTTGTATTGG + Intergenic
995012555 5:107274275-107274297 TGTAGGGACACCAGTTATATTGG - Intergenic
999893976 5:156008689-156008711 TATAAGGACACCAGTTGTATTGG + Intronic
1001085623 5:168698350-168698372 TTTAGAGACACCTGTTATATTGG - Intronic
1003265607 6:4562707-4562729 TGTAAGGACACCAGCCGTATTGG - Intergenic
1004315209 6:14580814-14580836 TATAAGGACACCAGTTGTATTGG - Intergenic
1007808044 6:44465408-44465430 TGTAAGGACACCAGGTGTATTGG + Intergenic
1011720855 6:90155171-90155193 TGTGGAGAAACCTGATGTTTTGG - Intronic
1014403742 6:121023047-121023069 TGTATGGACACCAAATCTATTGG - Intergenic
1017607123 6:156146415-156146437 TGCAGAGACACTTGATGTAAGGG + Intergenic
1018045201 6:159959765-159959787 TATAGGGACACCTGTTATGTGGG + Intergenic
1018728609 6:166632269-166632291 TGTAGGTATACCTCATGTAAGGG - Intronic
1024574800 7:50754905-50754927 TGTAAGGACACCGGTTGTATTGG - Intronic
1024667991 7:51564938-51564960 TACAGGGACACCTGATGTGGAGG - Intergenic
1024757764 7:52556277-52556299 TATAAGGACACCAGTTGTATTGG - Intergenic
1033409542 7:141104807-141104829 TATAAGGACACCAGTTGTATTGG + Intronic
1037209133 8:16363783-16363805 TGTAAGGACACCTGTCATATTGG - Intronic
1038485089 8:27929362-27929384 TGTAGGGACACCTGATGTATTGG - Intronic
1041723151 8:60994233-60994255 TATAAGGACACCAGTTGTATTGG + Intergenic
1042182761 8:66108416-66108438 TATAAGGACACCAGTTGTATTGG + Intergenic
1047693155 8:127377110-127377132 TATAAGGACACCAGTTGTATTGG - Intergenic
1051337523 9:16079395-16079417 TATAAGGACACCAGCTGTATTGG - Intergenic
1053647459 9:40131641-40131663 GGTAGGGTCACCTGATGGAAGGG + Intergenic
1053758268 9:41332202-41332224 GGTAGGGTCACCTGATGGAAGGG - Intergenic
1054328441 9:63729595-63729617 GGTAGGGTCACCTGATGGAAGGG + Intergenic
1054537120 9:66244529-66244551 GGTAGGGTCACCTGATGGAAGGG - Intergenic
1055997813 9:82180800-82180822 TTTAGGGATACCTTGTGTATAGG + Intergenic
1058173818 9:101714601-101714623 TATTTGGCCACCTGATGTATAGG + Intronic
1061116934 9:128619614-128619636 TGTAGGGACATCAGGTCTATTGG + Intronic
1202795244 9_KI270719v1_random:114938-114960 GGTAGGGTCACCTGATGGAAGGG + Intergenic
1187436220 X:19272328-19272350 TTTAAGGACACCAGTTGTATTGG + Intergenic
1188883515 X:35519857-35519879 TGTACAGACACCTCATGTCTAGG - Intergenic
1189286964 X:39858525-39858547 TCTAGGGACACCAGTTGTATTGG + Intergenic
1189954904 X:46267885-46267907 TGCAGGCACAGCTGATGTCTTGG - Intergenic
1193473089 X:81930559-81930581 TGTAAGGGCACCAGTTGTATTGG - Intergenic
1198910988 X:141614042-141614064 TATAGGGACACCAGTTATATTGG - Intronic
1198973269 X:142305040-142305062 TGTCAGGACACTTGATGTGTGGG + Intergenic
1201189757 Y:11436473-11436495 TGTAGGGAGGGCTGATGCATTGG + Intergenic
1201501211 Y:14644895-14644917 TGTTCTGACACCTGATGTAAAGG + Intronic