ID: 1038485092

View in Genome Browser
Species Human (GRCh38)
Location 8:27929378-27929400
Sequence CCTACCCAGCTGGCACTGTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 116
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 102}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1038485092_1038485097 -9 Left 1038485092 8:27929378-27929400 CCCTACAGTGCCAGCTGGGTAGG 0: 1
1: 0
2: 1
3: 12
4: 102
Right 1038485097 8:27929392-27929414 CTGGGTAGGTACATGTGTATGGG No data
1038485092_1038485096 -10 Left 1038485092 8:27929378-27929400 CCCTACAGTGCCAGCTGGGTAGG 0: 1
1: 0
2: 1
3: 12
4: 102
Right 1038485096 8:27929391-27929413 GCTGGGTAGGTACATGTGTATGG No data
1038485092_1038485101 11 Left 1038485092 8:27929378-27929400 CCCTACAGTGCCAGCTGGGTAGG 0: 1
1: 0
2: 1
3: 12
4: 102
Right 1038485101 8:27929412-27929434 GGGAGGGAAGAAGGAAGCTAAGG No data
1038485092_1038485100 2 Left 1038485092 8:27929378-27929400 CCCTACAGTGCCAGCTGGGTAGG 0: 1
1: 0
2: 1
3: 12
4: 102
Right 1038485100 8:27929403-27929425 CATGTGTATGGGAGGGAAGAAGG No data
1038485092_1038485102 12 Left 1038485092 8:27929378-27929400 CCCTACAGTGCCAGCTGGGTAGG 0: 1
1: 0
2: 1
3: 12
4: 102
Right 1038485102 8:27929413-27929435 GGAGGGAAGAAGGAAGCTAAGGG No data
1038485092_1038485098 -6 Left 1038485092 8:27929378-27929400 CCCTACAGTGCCAGCTGGGTAGG 0: 1
1: 0
2: 1
3: 12
4: 102
Right 1038485098 8:27929395-27929417 GGTAGGTACATGTGTATGGGAGG No data
1038485092_1038485099 -5 Left 1038485092 8:27929378-27929400 CCCTACAGTGCCAGCTGGGTAGG 0: 1
1: 0
2: 1
3: 12
4: 102
Right 1038485099 8:27929396-27929418 GTAGGTACATGTGTATGGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1038485092 Original CRISPR CCTACCCAGCTGGCACTGTA GGG (reversed) Intronic
900184552 1:1327001-1327023 CCCTTCCAGCTGGCAATGTAGGG - Exonic
900610439 1:3542387-3542409 CCAACCCGGCTGGCAGTGGAGGG + Intronic
901056086 1:6449164-6449186 CCTCCCCAGCTGTCACTGCCCGG + Intronic
901195497 1:7437754-7437776 CCTCCCCAGCTGGCCCTGTGGGG + Intronic
902478268 1:16699331-16699353 CCTCCCCAGCTGTCACTGCCCGG - Intergenic
902895294 1:19475601-19475623 CCTACCCAGTTGTCAGTGTCAGG - Intronic
905268941 1:36774005-36774027 CCGCCACAGCTGGCACTGAATGG + Intergenic
905311780 1:37054126-37054148 CATACAGAGCTGGCCCTGTAGGG + Intergenic
906647218 1:47483826-47483848 GCTTCCAACCTGGCACTGTAGGG - Intergenic
907012570 1:50977696-50977718 CCAGCCCAGCTTGCGCTGTACGG + Intergenic
907667047 1:56442458-56442480 CCTTCACAGCAGTCACTGTATGG + Intergenic
917442327 1:175078935-175078957 CCTGGCCAGCTGACACTGCAGGG - Intronic
920177617 1:204112937-204112959 TCTGCCCAGCTGGCCCTGGATGG + Exonic
921129581 1:212208323-212208345 GCTGTCCAGCTGGCACTGAATGG + Intergenic
924839831 1:247697280-247697302 CCTGCCCTGCTGTCACTGTTGGG - Intergenic
924902583 1:248417444-248417466 CCTAAACAGCTGGCAAGGTAGGG - Intergenic
1069065522 10:63938195-63938217 CCTTCCCAGCTGGGAATGGAGGG + Intergenic
1074832356 10:117257875-117257897 CTTACCCAGCTGCCACTTTCGGG - Exonic
1078149475 11:8746470-8746492 CCTACTCAGCTGGAACTCTTTGG - Intronic
1080272960 11:30470236-30470258 CCTACCCTACTGGCCCAGTATGG + Intronic
1082786883 11:57322240-57322262 CCTACCCAAGGGGCACTGTGGGG - Intronic
1086534286 11:87825406-87825428 CCAACCCTGCTGGCACCTTAAGG - Intergenic
1094827837 12:34286501-34286523 CCTTCCCAGCAGCCACTGTGTGG + Intergenic
1094828668 12:34289906-34289928 CCTACCCAGCAGTCCCTGCATGG - Intergenic
1094829610 12:34294072-34294094 CCTTCCCAGCTGCCCCTGTGTGG - Intergenic
1094831550 12:34302581-34302603 CCTACCCAGCAGCCACTGTGCGG + Intergenic
1094837347 12:34328318-34328340 CCTTCCCAGCAGCCACTGCATGG - Intergenic
1097048589 12:56206303-56206325 CCTGCCCTTCTGGCACTGAAGGG - Exonic
1102006691 12:109593526-109593548 GGTACCAAGCTGGCACTGGAAGG - Intronic
1113902242 13:113803798-113803820 CCTGCCCAGCGGGCACTGGAAGG - Intronic
1116783928 14:49267429-49267451 TCTACCCCTCTGGCATTGTAAGG - Intergenic
1121911236 14:97794348-97794370 CCCACCATGCTGGCATTGTAGGG + Intergenic
1123693990 15:22863667-22863689 CCTAAGCAGCTGGAACTGAATGG - Intronic
1125711356 15:41789571-41789593 CCAAGCCAACTGGCACTGCAGGG - Intronic
1126845773 15:52759315-52759337 TCTACCCAGCTGGAAATGAAAGG - Intronic
1128537407 15:68501445-68501467 CCCACCCAGGTGGCAGTGGACGG + Intergenic
1132092923 15:98960349-98960371 CCTAGCCAGGTGGCCCTGTGAGG + Exonic
1132755516 16:1482667-1482689 CCTGCCCAGCTGGCACCGTGGGG - Intergenic
1139776887 16:69322016-69322038 CCTAGCCATGTGGAACTGTAAGG - Intronic
1143112660 17:4560866-4560888 CCCACCCACCTGGGACTCTAGGG + Intergenic
1150594223 17:66590108-66590130 CCTGCCCAGCTGCCAGTGTATGG - Intronic
1157446211 18:47748567-47748589 CCCACCCACATGGCACTGCATGG + Intergenic
1158875960 18:61734853-61734875 CCTACCTAGCTGGGAGTATAAGG - Intergenic
1159872557 18:73775038-73775060 CCTACCTAGATGGCACTGCAGGG - Intergenic
1202712291 1_KI270714v1_random:25159-25181 CCTCCCCAGCTGTCACTGCCCGG - Intergenic
930025487 2:47026856-47026878 ACTTCCCAGCTGGCACCTTAGGG - Intronic
933215972 2:79630203-79630225 CTTCCCCAAGTGGCACTGTAAGG + Intronic
935065491 2:99643708-99643730 GGTACCCACCTGGCAGTGTAGGG - Intronic
936086818 2:109474869-109474891 CCTTCCCTGCTGGCTCTGGAGGG - Intronic
940015391 2:149099353-149099375 ACTGCCCAGCTGAGACTGTAAGG - Intronic
943649602 2:190442659-190442681 CATACCAAGCTGGAAATGTAGGG - Intronic
947842702 2:233218604-233218626 CTTACCCTGCAGGCACTGTTGGG + Intronic
1170632133 20:18074739-18074761 CCTACAGAGCTGGCTCTGTCTGG - Intergenic
1173656352 20:44702900-44702922 CCTGCCAAGCTGGCACTTTGAGG + Intergenic
1175259187 20:57664080-57664102 CCTCGCCAGCAGGCACTGCATGG - Intronic
1176035699 20:63035461-63035483 CCAATCCAGATGGCACTGCAGGG + Intergenic
1176430063 21:6569955-6569977 CCTTCCAAGCTGGCACTGTCTGG - Intergenic
1178876612 21:36419115-36419137 TCAACCCAGCAGCCACTGTAAGG - Intergenic
1179705457 21:43177417-43177439 CCTTCCAAGCTGGCACTGTCTGG - Intergenic
1181677491 22:24465670-24465692 CCTATCCATCTGGCAAGGTATGG + Intergenic
955791466 3:62592696-62592718 CCTTCACAGCTGGCAGTGCATGG + Exonic
956714433 3:72065978-72066000 CCTCCCCAGCTGACACTCCATGG - Intergenic
957176257 3:76814409-76814431 CCTTGGCAGCTGTCACTGTAAGG + Intronic
962362407 3:134753374-134753396 CCTTCCCAGCAAGCACTATATGG + Intronic
967824642 3:193868748-193868770 CCCACCCAGAGGGCACTGGAGGG + Intergenic
969533482 4:7741879-7741901 CCTCCCCACCGGGCACTGTTTGG - Exonic
969846392 4:9923412-9923434 ACTGCCCTGCTGACACTGTACGG + Intronic
974470838 4:62315956-62315978 GCCACCCAGCAGGCACTGGAGGG - Intergenic
976354240 4:84097367-84097389 ACTGCCCTGCTGACACTGTATGG - Intergenic
985649585 5:1101167-1101189 CCTAAGCAGCTGGCACTGGGTGG + Intronic
986137060 5:4990304-4990326 ACTGCCCTGCTGACACTGTACGG + Intergenic
988237223 5:28561406-28561428 CCTAAGCAGCTGCCACTTTAAGG + Intergenic
989113071 5:37926253-37926275 CTTCCCCAGGTGGCTCTGTATGG - Intergenic
990669090 5:58107148-58107170 CGTATCCAGCTTGCACTCTAGGG + Intergenic
996716222 5:126590066-126590088 TCTGCCCAGCTGCCACTGTCTGG + Intronic
998071875 5:139204150-139204172 CCACCCCAGCTGACAGTGTATGG - Intronic
999073953 5:148777434-148777456 CCTGCCCAGATGCCACTGCAGGG - Intergenic
999266347 5:150269340-150269362 CCCACCCTGCTGGGACTGTCTGG - Intronic
1001472834 5:172027053-172027075 CCTCCCAAGCTGGAACTATAGGG + Intergenic
1002059851 5:176619926-176619948 CACTCCCAGCTGGCACTTTAGGG + Intergenic
1002808542 6:602830-602852 CCTTCCCATCTTGCACTGTAGGG - Intronic
1006183931 6:32169785-32169807 GCTACCCATCTGGCAGGGTATGG + Intronic
1008930467 6:56933496-56933518 CCTGCTCACCTGGCACGGTAAGG - Intronic
1012004174 6:93691969-93691991 CCTGGCCAGCTGGCACTGCTTGG + Intergenic
1017011595 6:150067329-150067351 ACTACCCATCTGGCTCTGTGGGG - Intronic
1019355109 7:574358-574380 CCTACCCAGCTGGAGCTGAGAGG - Intronic
1020747223 7:12092743-12092765 ACTGCCCTGCTGACACTGTAAGG + Intergenic
1022306071 7:29147661-29147683 CCTACCCACCTAGCTCTTTAAGG + Intronic
1022415990 7:30177421-30177443 CTTTCCCAGCTGTCACTGCAGGG - Intergenic
1023266363 7:38410362-38410384 CCAACCCAGATGGCAGTGTGGGG + Intronic
1026845161 7:73694682-73694704 CCTACCGAGCAGGCACATTAAGG - Intronic
1027262048 7:76471742-76471764 CCTACCCAGAGGGCAAAGTAGGG - Intronic
1027313430 7:76969837-76969859 CCTACCCAGAGGGCAAAGTAGGG - Intergenic
1029496571 7:100898120-100898142 CCTCCACAGCTGTCACTGCAGGG + Intergenic
1030042441 7:105464367-105464389 CCGACACAGCTGGCACAGTCCGG - Intronic
1031373072 7:120990969-120990991 CCTACCTAAATGGCACTGTCAGG - Intronic
1033773427 7:144579830-144579852 ACAACCCAGCTGGAGCTGTATGG + Intronic
1035623078 8:1049381-1049403 CCTACCCAGGTGGCACTGGTTGG - Intergenic
1037876108 8:22549358-22549380 CCTCCACAGCTGGCACGGTTAGG - Intronic
1038025989 8:23591177-23591199 CCTGTCCAGCTGGCACAGCAGGG + Intergenic
1038250731 8:25901799-25901821 CAAACACAGCTGGCACTGTACGG + Intronic
1038485092 8:27929378-27929400 CCTACCCAGCTGGCACTGTAGGG - Intronic
1038645796 8:29361121-29361143 TCTACCCAGCAGGCACTGTAAGG + Intergenic
1039223535 8:35362391-35362413 TCTACCCAGAAGGCACTTTATGG - Intronic
1040633938 8:49249930-49249952 CCTTTCCTGCTGGCACTGAAAGG + Intergenic
1042555243 8:70028865-70028887 CCTAGCCACGTGGAACTGTAAGG - Intergenic
1055123332 9:72688929-72688951 TCTATCCAGTTGGCACTATAAGG + Intronic
1056136561 9:83635115-83635137 ACTACCCAGCTGGGACTCCAGGG + Intronic
1186233152 X:7478027-7478049 TCTGCCCATATGGCACTGTAGGG + Intergenic
1188049986 X:25473107-25473129 CCTACCCAGCTGGTAGAGGACGG + Intergenic
1189032294 X:37462996-37463018 GCCACCTAGCTGGCACTGTAAGG + Intronic
1194581628 X:95679335-95679357 CCTACACAGCTGTCAGAGTATGG + Intergenic
1197760972 X:130028056-130028078 CCTACCTAGCTGGCAGTCAAGGG - Intronic
1200466665 Y:3528439-3528461 ACTAACCAGCAGGCAATGTAAGG - Intergenic
1200957062 Y:8960345-8960367 CAAACCCAGCTTGCACCGTATGG + Intergenic
1202193720 Y:22273624-22273646 CAAACCCAGCTTGCACCGTATGG - Intergenic