ID: 1038485094

View in Genome Browser
Species Human (GRCh38)
Location 8:27929379-27929401
Sequence ACCTACCCAGCTGGCACTGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 121
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 114}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1038485094_1038485101 10 Left 1038485094 8:27929379-27929401 CCTACAGTGCCAGCTGGGTAGGT 0: 1
1: 0
2: 0
3: 6
4: 114
Right 1038485101 8:27929412-27929434 GGGAGGGAAGAAGGAAGCTAAGG No data
1038485094_1038485098 -7 Left 1038485094 8:27929379-27929401 CCTACAGTGCCAGCTGGGTAGGT 0: 1
1: 0
2: 0
3: 6
4: 114
Right 1038485098 8:27929395-27929417 GGTAGGTACATGTGTATGGGAGG No data
1038485094_1038485099 -6 Left 1038485094 8:27929379-27929401 CCTACAGTGCCAGCTGGGTAGGT 0: 1
1: 0
2: 0
3: 6
4: 114
Right 1038485099 8:27929396-27929418 GTAGGTACATGTGTATGGGAGGG No data
1038485094_1038485102 11 Left 1038485094 8:27929379-27929401 CCTACAGTGCCAGCTGGGTAGGT 0: 1
1: 0
2: 0
3: 6
4: 114
Right 1038485102 8:27929413-27929435 GGAGGGAAGAAGGAAGCTAAGGG No data
1038485094_1038485100 1 Left 1038485094 8:27929379-27929401 CCTACAGTGCCAGCTGGGTAGGT 0: 1
1: 0
2: 0
3: 6
4: 114
Right 1038485100 8:27929403-27929425 CATGTGTATGGGAGGGAAGAAGG No data
1038485094_1038485097 -10 Left 1038485094 8:27929379-27929401 CCTACAGTGCCAGCTGGGTAGGT 0: 1
1: 0
2: 0
3: 6
4: 114
Right 1038485097 8:27929392-27929414 CTGGGTAGGTACATGTGTATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1038485094 Original CRISPR ACCTACCCAGCTGGCACTGT AGG (reversed) Intronic
900931702 1:5742084-5742106 ACCTTCCCACCTGGCCCTGACGG + Intergenic
901195495 1:7437753-7437775 GCCTCCCCAGCTGGCCCTGTGGG + Intronic
902160977 1:14530158-14530180 ACCTGCCCTCCTGGCACTGGGGG - Intergenic
903775502 1:25790798-25790820 ACCTGCCCACCAGGCACTGAGGG - Intergenic
904111956 1:28133213-28133235 GCCTCCCCAGCTGGGACTATAGG + Intergenic
904129278 1:28263519-28263541 TCCTTCCCAGCTGGCAGAGTGGG + Intronic
905529001 1:38661652-38661674 ACCCACCCAGATGGCACTGATGG + Intergenic
905601072 1:39251963-39251985 AGCATCCCAGCTGGCACTGCTGG + Intronic
919762151 1:201104866-201104888 ACATGCCCAGGTGGCTCTGTGGG - Intronic
920537142 1:206745156-206745178 ACTTAGCCTGCTGGGACTGTGGG - Intergenic
920684726 1:208100812-208100834 ACCTGCCCACCTGCTACTGTGGG - Intronic
924470576 1:244339526-244339548 TCCCAAGCAGCTGGCACTGTAGG + Intergenic
924839833 1:247697281-247697303 GCCTGCCCTGCTGTCACTGTTGG - Intergenic
1062802667 10:391606-391628 ACCCACACAGCTGGCACAGCTGG - Intronic
1066427203 10:35318336-35318358 ACCTACCCATGTGCAACTGTGGG + Intronic
1068648598 10:59496956-59496978 GCCTACCCAACTGACACTGCAGG - Intergenic
1069029550 10:63580886-63580908 TCCCAAGCAGCTGGCACTGTAGG - Intronic
1069291093 10:66780487-66780509 ATCTAGCCAGCTGTCACTGCTGG - Intronic
1070214070 10:74357416-74357438 ACCCTCCCAGCTGGTACTGAAGG + Intronic
1070776935 10:79115255-79115277 ACCTACCCAGCTGCCCTTGTGGG + Intronic
1074832357 10:117257876-117257898 CCTTACCCAGCTGCCACTTTCGG - Exonic
1077522703 11:3045729-3045751 ACCTTCCTTGCTGGCACAGTGGG - Intronic
1078679180 11:13459660-13459682 ACTTACCCAGTTAGAACTGTAGG + Intronic
1082786885 11:57322241-57322263 TCCTACCCAAGGGGCACTGTGGG - Intronic
1084307879 11:68298629-68298651 AGCTATCCTGCTGGCACAGTAGG + Intergenic
1087499628 11:98933470-98933492 CCCTGACAAGCTGGCACTGTGGG + Intergenic
1089392301 11:118110494-118110516 ACCAGCCCAGCTGGGACTATAGG + Intronic
1089634434 11:119803354-119803376 GCCTCCCCACCTGGCACTGATGG + Intergenic
1090747551 11:129719479-129719501 AAATACCCACCTGCCACTGTTGG - Intergenic
1111253249 13:85633115-85633137 TCCTTTCCAGCTGGCACTTTTGG + Intergenic
1112262325 13:97888278-97888300 ACCAGCCCAGTTGGCACTGTTGG + Intergenic
1114200484 14:20515461-20515483 CCCTACCCACATGGCACTGCTGG - Intergenic
1115500703 14:34046967-34046989 ACCTACCAAGCTAGCATTTTTGG + Intronic
1115701843 14:35961186-35961208 ATCTAGCCAGCTGCCAATGTTGG - Intergenic
1115845764 14:37531806-37531828 CCTTACAGAGCTGGCACTGTAGG + Intronic
1116102918 14:40464830-40464852 AGCTGGCCAGCTGGCAGTGTGGG - Intergenic
1116119387 14:40703087-40703109 ACCTACCCAACTGACACTATTGG + Intergenic
1117485834 14:56195808-56195830 ATCTGCCCAGCTGGCAGTTTGGG + Intronic
1117914132 14:60659270-60659292 ACCCACCCAGCTAGCAGTGAGGG - Intergenic
1119573123 14:75694052-75694074 ACCAAGCCTGCTGCCACTGTAGG + Intronic
1120332549 14:83112148-83112170 TAATACCCAGCTGGAACTGTAGG - Intergenic
1125374802 15:39017003-39017025 ACCTGACTAGCTGGCCCTGTGGG - Intergenic
1126532464 15:49725763-49725785 CCCTACCCAACTGACACTCTAGG + Intergenic
1127110808 15:55667824-55667846 ACCTACCATCCTGGCACTTTGGG + Intronic
1129109016 15:73326908-73326930 TCCTAAACAGCTGGCACTATAGG + Intronic
1132755518 16:1482668-1482690 CCCTGCCCAGCTGGCACCGTGGG - Intergenic
1137268783 16:46888907-46888929 ACCTACCCACCCAGCACTTTGGG - Intronic
1142252804 16:89000441-89000463 GCCCATCCGGCTGGCACTGTGGG + Intergenic
1143983380 17:10890280-10890302 ACATAGCCAGAAGGCACTGTTGG + Intergenic
1145734077 17:27214171-27214193 CCCTGACCAGCTGGCACTGCAGG + Intergenic
1152589467 17:81204292-81204314 CCCTCCCCAGCTGGCCCTGCAGG + Intronic
1156298821 18:35817856-35817878 ACCTAGGCTGCTGGCACTGAGGG + Intergenic
1156465519 18:37345964-37345986 ACCTGCCCAGCTGCCACTCCAGG - Intronic
1157385591 18:47257441-47257463 ATCTCCCCAGCTGACACTGGTGG + Intergenic
1158626803 18:59078601-59078623 GCCTTCCCAGCTGGCAGTCTGGG + Intergenic
1159872559 18:73775039-73775061 TCCTACCTAGATGGCACTGCAGG - Intergenic
1164448045 19:28334360-28334382 TCCTCCCCTGCTGGCAGTGTTGG - Intergenic
1165742573 19:38212374-38212396 ACCCGCCCAGCTGGCACCCTGGG + Intronic
927097344 2:19757570-19757592 GCCTCCCCAGCCGGCACTCTGGG + Intergenic
927645712 2:24875556-24875578 ACCTTCCCAGGTGACCCTGTCGG - Intronic
930088570 2:47515860-47515882 TCATCCCCAGCTGACACTGTGGG + Intronic
932423878 2:71617091-71617113 CCATACCCAGCTGGCTCTGGGGG - Intronic
932724556 2:74168013-74168035 TCCTACATAGCTGGGACTGTAGG - Intronic
937969445 2:127537981-127538003 GCCTCCCCAGCTGGCAGTGAAGG - Intronic
940470724 2:154096299-154096321 ACATACCCAGCTGGCATAATTGG + Intronic
942546825 2:177074144-177074166 ACCTACCCAGTAGATACTGTTGG + Intergenic
945582067 2:211607982-211608004 ACCTAACAAGCTGGGACTATAGG + Intronic
946767087 2:223050816-223050838 AAATCCCCAGCTGGCACTGGAGG - Intergenic
947842701 2:233218603-233218625 GCTTACCCTGCAGGCACTGTTGG + Intronic
1170126447 20:12969532-12969554 CCCTGACCAGCTGGCACTGCGGG - Intergenic
1173217725 20:41101826-41101848 ACCTACCCAGATGAGACTGCAGG - Intronic
1180959748 22:19757164-19757186 CCCCACCCAGCCGGCTCTGTTGG - Intronic
1181482338 22:23208223-23208245 ACCCACCCGGCTGGCAGTGCAGG + Intronic
1182895549 22:33856310-33856332 ACCCACCCAGCTTGTTCTGTCGG - Intronic
954172796 3:48818628-48818650 TCCCAAGCAGCTGGCACTGTAGG - Intronic
954846245 3:53560127-53560149 CCATACCCAGCTAGCACTTTTGG + Intronic
956693930 3:71902701-71902723 ACATACCCAGCTGGCATTTGAGG + Intergenic
959003719 3:100995114-100995136 ATTTATCCAGCTGGCACTGCTGG + Intergenic
960006477 3:112786504-112786526 ACATAGCCAGCTAGCACTCTGGG + Intronic
960869580 3:122235134-122235156 ACCTTCCCATCTGGGACTGATGG + Intronic
966891365 3:184409732-184409754 CCCAGCCCAGCTAGCACTGTCGG - Intronic
967824640 3:193868747-193868769 ACCCACCCAGAGGGCACTGGAGG + Intergenic
968891210 4:3369440-3369462 ACCTAGCCTGGTGGCCCTGTGGG + Intronic
970376735 4:15465957-15465979 ACGTGCCCAGCTAGCTCTGTTGG + Intergenic
982368452 4:154606432-154606454 ACCATCATAGCTGGCACTGTGGG - Intronic
982751083 4:159162817-159162839 ACCTTGCATGCTGGCACTGTGGG - Intronic
984111527 4:175622678-175622700 ACCCTTCCAGCTGGTACTGTGGG + Intergenic
988954889 5:36305587-36305609 AGTTTCCCAGGTGGCACTGTTGG + Intergenic
993613673 5:90084576-90084598 ACTGTCCCAGCTGGCAATGTGGG + Intergenic
994049344 5:95344894-95344916 ATCTGTCCAGCTGGCAATGTAGG - Intergenic
998574642 5:143300623-143300645 CCCTACCCTGGTGTCACTGTTGG - Exonic
1002808544 6:602831-602853 TCCTTCCCATCTTGCACTGTAGG - Intronic
1003921182 6:10834958-10834980 CCCTGCTCAGCTGGCGCTGTGGG + Intronic
1007958747 6:45940051-45940073 GCCCTCCAAGCTGGCACTGTGGG + Intronic
1008026963 6:46649136-46649158 CACTACCCAGCTGACACGGTTGG + Intronic
1010428818 6:75755107-75755129 TCCTACACAGCTAGCACTATAGG - Intronic
1012968278 6:105699238-105699260 AGCTTCCCAACTGGCCCTGTTGG + Intergenic
1017011596 6:150067330-150067352 GACTACCCATCTGGCTCTGTGGG - Intronic
1023266361 7:38410361-38410383 CCCAACCCAGATGGCAGTGTGGG + Intronic
1026425703 7:70290712-70290734 ACCTGCCCAGCTGGGATTTTTGG + Intronic
1031265387 7:119573496-119573518 GCCTCCCCAGCTGGCACTAGTGG - Intergenic
1031589504 7:123572263-123572285 TCCTACGTAGCTGGGACTGTAGG + Intronic
1031931676 7:127692058-127692080 ACATATCCAGATGGCACGGTGGG + Intronic
1036377485 8:8213396-8213418 ACTTCCCCAGCTGACACTGCTGG + Intergenic
1036852073 8:12209752-12209774 ACTTCCCCAGCTGACACTGCTGG - Intergenic
1036873440 8:12452274-12452296 ACTTCCCCAGCTGACACTGCTGG - Intergenic
1037125463 8:15342681-15342703 ACTGCCCCAGTTGGCACTGTGGG - Intergenic
1037571874 8:20164863-20164885 ACTTACCCAGCTGCCACTTGGGG + Exonic
1038485094 8:27929379-27929401 ACCTACCCAGCTGGCACTGTAGG - Intronic
1038635865 8:29286740-29286762 ACCTATCAAGCTGGCACTCAGGG + Intergenic
1040359504 8:46651806-46651828 CCCTCACAAGCTGGCACTGTGGG - Intergenic
1041974919 8:63787175-63787197 ATCTATCCCCCTGGCACTGTAGG - Intergenic
1046993104 8:120483211-120483233 GCCTCCCCAGCTGGCACTAAGGG + Intronic
1049190283 8:141283658-141283680 AGCTGCCCAGCAGTCACTGTAGG - Intronic
1050716208 9:8529240-8529262 ACTCTCCAAGCTGGCACTGTTGG - Intronic
1056825793 9:89875580-89875602 ACCTGCACAGCTGGCACGCTGGG - Intergenic
1188727890 X:33607479-33607501 CCCTACCCAGTTGGCAGGGTGGG - Intergenic
1192722686 X:73716305-73716327 CCCTGACAAGCTGGCACTGTGGG + Intergenic
1193046856 X:77063079-77063101 TCCTGCCCAGCTGGCAGTGATGG + Intergenic
1202342816 Y:23887670-23887692 ACAAACCCAGCTGTCATTGTGGG - Intergenic
1202527952 Y:25782415-25782437 ACAAACCCAGCTGTCATTGTGGG + Intergenic