ID: 1038485097

View in Genome Browser
Species Human (GRCh38)
Location 8:27929392-27929414
Sequence CTGGGTAGGTACATGTGTAT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1038485092_1038485097 -9 Left 1038485092 8:27929378-27929400 CCCTACAGTGCCAGCTGGGTAGG 0: 1
1: 0
2: 1
3: 12
4: 102
Right 1038485097 8:27929392-27929414 CTGGGTAGGTACATGTGTATGGG No data
1038485089_1038485097 7 Left 1038485089 8:27929362-27929384 CCAATACATCAGGTGTCCCTACA 0: 1
1: 0
2: 2
3: 16
4: 119
Right 1038485097 8:27929392-27929414 CTGGGTAGGTACATGTGTATGGG No data
1038485087_1038485097 9 Left 1038485087 8:27929360-27929382 CCCCAATACATCAGGTGTCCCTA 0: 1
1: 0
2: 0
3: 10
4: 94
Right 1038485097 8:27929392-27929414 CTGGGTAGGTACATGTGTATGGG No data
1038485088_1038485097 8 Left 1038485088 8:27929361-27929383 CCCAATACATCAGGTGTCCCTAC 0: 1
1: 0
2: 0
3: 6
4: 74
Right 1038485097 8:27929392-27929414 CTGGGTAGGTACATGTGTATGGG No data
1038485083_1038485097 26 Left 1038485083 8:27929343-27929365 CCAGATAGGCTGCCTTCCCCCAA 0: 1
1: 0
2: 1
3: 26
4: 138
Right 1038485097 8:27929392-27929414 CTGGGTAGGTACATGTGTATGGG No data
1038485085_1038485097 14 Left 1038485085 8:27929355-27929377 CCTTCCCCCAATACATCAGGTGT 0: 1
1: 0
2: 1
3: 22
4: 178
Right 1038485097 8:27929392-27929414 CTGGGTAGGTACATGTGTATGGG No data
1038485082_1038485097 30 Left 1038485082 8:27929339-27929361 CCAACCAGATAGGCTGCCTTCCC 0: 1
1: 0
2: 1
3: 14
4: 189
Right 1038485097 8:27929392-27929414 CTGGGTAGGTACATGTGTATGGG No data
1038485094_1038485097 -10 Left 1038485094 8:27929379-27929401 CCTACAGTGCCAGCTGGGTAGGT 0: 1
1: 0
2: 0
3: 6
4: 114
Right 1038485097 8:27929392-27929414 CTGGGTAGGTACATGTGTATGGG No data
1038485086_1038485097 10 Left 1038485086 8:27929359-27929381 CCCCCAATACATCAGGTGTCCCT 0: 1
1: 0
2: 0
3: 11
4: 138
Right 1038485097 8:27929392-27929414 CTGGGTAGGTACATGTGTATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1038485097 Original CRISPR CTGGGTAGGTACATGTGTAT GGG Intronic
No off target data available for this crispr