ID: 1038489809

View in Genome Browser
Species Human (GRCh38)
Location 8:27962648-27962670
Sequence GGGATACTCAGTTCAAAGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1038489803_1038489809 16 Left 1038489803 8:27962609-27962631 CCAGGGACAGACCTGCTTGAAAC 0: 1
1: 0
2: 0
3: 13
4: 111
Right 1038489809 8:27962648-27962670 GGGATACTCAGTTCAAAGCCAGG No data
1038489802_1038489809 26 Left 1038489802 8:27962599-27962621 CCTGCAAAGTCCAGGGACAGACC 0: 1
1: 0
2: 4
3: 15
4: 199
Right 1038489809 8:27962648-27962670 GGGATACTCAGTTCAAAGCCAGG No data
1038489805_1038489809 5 Left 1038489805 8:27962620-27962642 CCTGCTTGAAACAAGGTGATCCA 0: 1
1: 0
2: 1
3: 11
4: 82
Right 1038489809 8:27962648-27962670 GGGATACTCAGTTCAAAGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1038489809 Original CRISPR GGGATACTCAGTTCAAAGCC AGG Intronic
No off target data available for this crispr