ID: 1038493744

View in Genome Browser
Species Human (GRCh38)
Location 8:27987620-27987642
Sequence CCTTCTCTGCAGCTGTTGCA GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 337
Summary {0: 1, 1: 0, 2: 3, 3: 38, 4: 295}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1038493744_1038493754 5 Left 1038493744 8:27987620-27987642 CCCTGCAACAGCTGCAGAGAAGG 0: 1
1: 0
2: 3
3: 38
4: 295
Right 1038493754 8:27987648-27987670 GGGGAGGAGAGGGAGGACGAAGG 0: 1
1: 2
2: 71
3: 585
4: 3960
1038493744_1038493756 10 Left 1038493744 8:27987620-27987642 CCCTGCAACAGCTGCAGAGAAGG 0: 1
1: 0
2: 3
3: 38
4: 295
Right 1038493756 8:27987653-27987675 GGAGAGGGAGGACGAAGGCCGGG 0: 1
1: 0
2: 5
3: 81
4: 837
1038493744_1038493752 -5 Left 1038493744 8:27987620-27987642 CCCTGCAACAGCTGCAGAGAAGG 0: 1
1: 0
2: 3
3: 38
4: 295
Right 1038493752 8:27987638-27987660 GAAGGCAAGAGGGGAGGAGAGGG 0: 1
1: 3
2: 31
3: 352
4: 2670
1038493744_1038493755 9 Left 1038493744 8:27987620-27987642 CCCTGCAACAGCTGCAGAGAAGG 0: 1
1: 0
2: 3
3: 38
4: 295
Right 1038493755 8:27987652-27987674 AGGAGAGGGAGGACGAAGGCCGG 0: 1
1: 0
2: 6
3: 135
4: 1366
1038493744_1038493751 -6 Left 1038493744 8:27987620-27987642 CCCTGCAACAGCTGCAGAGAAGG 0: 1
1: 0
2: 3
3: 38
4: 295
Right 1038493751 8:27987637-27987659 AGAAGGCAAGAGGGGAGGAGAGG 0: 2
1: 0
2: 23
3: 360
4: 3104
1038493744_1038493753 -2 Left 1038493744 8:27987620-27987642 CCCTGCAACAGCTGCAGAGAAGG 0: 1
1: 0
2: 3
3: 38
4: 295
Right 1038493753 8:27987641-27987663 GGCAAGAGGGGAGGAGAGGGAGG 0: 1
1: 2
2: 39
3: 344
4: 2539

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1038493744 Original CRISPR CCTTCTCTGCAGCTGTTGCA GGG (reversed) Exonic
900688425 1:3964493-3964515 TCTTGTCTGCAGCAGCTGCACGG - Intergenic
903621380 1:24700780-24700802 GCTGCTCTGCAGCGGTTTCAGGG + Intergenic
904941020 1:34164943-34164965 CCGCCTCTGCTGCTGTTGCTGGG - Exonic
906202807 1:43970954-43970976 TCTTCCCTGCAGCTGCTGCGTGG + Exonic
906293526 1:44635293-44635315 CTTTGGCTGCAGCTGGTGCAAGG - Intronic
907576659 1:55532712-55532734 CCGCCTGTTCAGCTGTTGCATGG - Intergenic
909056285 1:70824975-70824997 CCTTCTCTACTGCTGTTGGTGGG + Intergenic
910593471 1:88952953-88952975 CCTTCTATCCTTCTGTTGCAGGG - Intronic
910749794 1:90616599-90616621 CATTCTCTGGAGCAGTTGCTGGG + Intergenic
911653698 1:100418766-100418788 CCGTCTCTCAAGCTGTTGAAGGG + Intronic
912252749 1:108027998-108028020 CCTTCTCTGCATCTCCTGCTTGG + Intergenic
913003658 1:114606992-114607014 CCTTGCCTGGAGATGTTGCAGGG + Intronic
914918013 1:151830222-151830244 CCTTCTCTGCTGCTGCTGCGTGG + Intronic
917055443 1:170976838-170976860 CTTTCTCTCCATCTATTGCAGGG + Intronic
917464595 1:175264739-175264761 CCTTCTCAGTTGCTTTTGCAAGG - Intergenic
917709611 1:177671035-177671057 CCTTTTCTGCAATGGTTGCAGGG + Intergenic
919131510 1:193456652-193456674 TCTTCTCTGCAGCTGTCTCAGGG - Intergenic
920070939 1:203302721-203302743 GCCCCTCTGCTGCTGTTGCATGG - Intergenic
921097884 1:211902462-211902484 CCTTCTCTTCAACTGTAACATGG - Intergenic
921571891 1:216789693-216789715 CCTTTTCTGGAACTGTAGCAAGG + Intronic
922176801 1:223203330-223203352 CCCTCTCTGCAGATGTTTCAGGG - Intergenic
923897471 1:238288095-238288117 CCTTGTCTGCAGAAGTTGTAAGG - Intergenic
924039897 1:239974193-239974215 CCGTTTCTGCTGCTGTGGCAGGG - Intergenic
1062768256 10:81289-81311 CAGTCTCTGCAGCTGCTGAAAGG - Intergenic
1063120600 10:3103156-3103178 CATTCTCTGAAGCTGTTGCCAGG + Intronic
1063162347 10:3428195-3428217 CCGCCTCTGCAGCTGCTGAAAGG - Intergenic
1063961517 10:11309924-11309946 CCTGCTCTGGAGGTGGTGCAGGG + Intronic
1064311957 10:14219686-14219708 CCTTCTCTGAAGGTGTTACATGG - Intronic
1067130004 10:43555290-43555312 TCTTCTCTGCAGAAGTTGAATGG - Intergenic
1067282316 10:44881726-44881748 CCTTCTGTGCACCTGGAGCATGG - Intergenic
1067566821 10:47345624-47345646 CCTGCGCTGCAGGTGCTGCAGGG + Intergenic
1068353503 10:55880921-55880943 GCTCCACTGCAGCTGTTCCAAGG - Intergenic
1068384961 10:56314414-56314436 CCTTCTCTACAGGTGTTAGAGGG + Intergenic
1068444931 10:57108708-57108730 CCTTCCCAGCAGCAGTGGCAAGG + Intergenic
1070005025 10:72415490-72415512 ACTTCTCTTCAACTGTTGCCTGG + Intronic
1070805877 10:79270414-79270436 CCTTGGGTGCAGCTGGTGCAGGG + Intronic
1071207811 10:83302235-83302257 CCTGCTCTGCATCTGTGGGAGGG + Intergenic
1072019786 10:91386975-91386997 CCTTCTGTTTAGCTGTTCCATGG + Intergenic
1072539475 10:96387237-96387259 CCTTCACTGTAGCTGCTGCCTGG - Intronic
1072680174 10:97500031-97500053 CCTTCTTTGAGGGTGTTGCAAGG + Intronic
1073466385 10:103696787-103696809 CATTCTCTGCAGCTGGTCCAGGG + Intronic
1073614555 10:104980347-104980369 CCATCTCTGCAAGTGTTGCCAGG - Intronic
1073854770 10:107661708-107661730 CCTTCCCTGAGGCAGTTGCAGGG + Intergenic
1075054674 10:119208236-119208258 CCATCTCGGCAGCTGTTGAAAGG + Intronic
1076542043 10:131220649-131220671 CCTTCTCTACAGCTGAGGCAGGG - Intronic
1076797770 10:132806903-132806925 CGTTCTCTGCTTCTGTTGCTTGG + Intergenic
1077967283 11:7148415-7148437 CCTTTTCTGCATCTATTGAAAGG - Intergenic
1078409000 11:11095965-11095987 CCTTGCCTGCTGGTGTTGCATGG - Intergenic
1078843371 11:15099846-15099868 TCTTCTCTTGAGCTTTTGCATGG - Intergenic
1079487509 11:20950886-20950908 CCTTCGGTGCAGGTGTTGAAAGG - Intronic
1079935538 11:26611573-26611595 TTTACTCTGCAGCTGTTGGATGG + Intronic
1080430574 11:32195232-32195254 CCTGTTCTGCCTCTGTTGCAGGG - Intergenic
1083445194 11:62703784-62703806 CCTTCTCTGCATCTGTTGATAGG + Intronic
1083591858 11:63900207-63900229 CCTTCTCTGAAGCTTTGGCTTGG - Intronic
1083950690 11:65953931-65953953 CAATCTCTGCAGCTGTTGAATGG + Intronic
1084455666 11:69266816-69266838 CTTTCTCTGCACCAGGTGCAGGG - Intergenic
1085311666 11:75520586-75520608 CCTCCTCTGCTGCTGATTCATGG - Intronic
1086289155 11:85286445-85286467 CCTTCTCAGCAGATGGAGCAAGG - Intronic
1089908906 11:122075701-122075723 GCCTCTCTGCAGCTTTTGCTGGG + Intergenic
1090241146 11:125182764-125182786 CCTTCTCTGTAGCTGCTGGCAGG - Intronic
1091685196 12:2556435-2556457 CCTCCTCTGCAGCTCTTGGGTGG + Intronic
1092602887 12:10085860-10085882 CATACTCTGCAGTTGTTGGATGG - Intronic
1093098651 12:15000976-15000998 CATAATCTGCAGCTGCTGCATGG + Intergenic
1094830159 12:34296480-34296502 CCTTCCCAGCAGCCCTTGCACGG + Intergenic
1094833362 12:34310936-34310958 CCTTCTCAGCAGCTCCTGCACGG + Intergenic
1094835941 12:34322121-34322143 CCTTCCCAGCAGCTGCTGCATGG - Intergenic
1094836187 12:34323193-34323215 CCTTCTCAGCAGCCCATGCACGG - Intergenic
1095482614 12:42651629-42651651 ACTTCTCTGAAGCTGTTTCTAGG - Intergenic
1096665547 12:53161564-53161586 CCATCTCTGCAGCTTCTGCTTGG - Intronic
1096867517 12:54573691-54573713 CCACCTCTCCAGCTGTTGCAAGG - Exonic
1096876637 12:54634800-54634822 TCTTCTTGGCAGCTGTAGCAGGG - Exonic
1097818222 12:64098887-64098909 CCTTCACAGCAGATGTTGAATGG - Intronic
1098278871 12:68841975-68841997 GTTCATCTGCAGCTGTTGCAAGG + Exonic
1099234548 12:80068250-80068272 CCTTCCCTTCAGCTCTTGCTGGG - Intergenic
1099508113 12:83503393-83503415 CCTCCTCTGAAGCAGTTGCCAGG + Intergenic
1102875280 12:116444155-116444177 CCTCCACAGCAGCTGTTGCAGGG + Intergenic
1103058439 12:117839845-117839867 TCTTCTCTGCTGCTGATGCCTGG - Intronic
1103713973 12:122932400-122932422 CCTGCCCTGCAGCTGTGGAAAGG + Intronic
1104483327 12:129127932-129127954 GCTTCTGTGCAGCTGTCACATGG + Intronic
1104818969 12:131664091-131664113 CCCTCACTGCAGCTGTGGGAAGG - Intergenic
1106690490 13:32109979-32110001 CCATCACAGCAGCTGATGCAGGG + Intronic
1109130910 13:58584462-58584484 CCTACACTGCAGGTATTGCATGG - Intergenic
1110101617 13:71613467-71613489 TCATCACTGTAGCTGTTGCAAGG + Intronic
1111816515 13:93160737-93160759 CCTTAGCTGGAGCTGTTGCCTGG - Intergenic
1113828624 13:113276639-113276661 CCCCTTCTGCAGCTGGTGCAAGG - Intergenic
1113945381 13:114041093-114041115 TCTTCTCTGCTTGTGTTGCAGGG - Exonic
1114484500 14:23054887-23054909 CCTTCCCTGCTGCTGCTGAATGG - Intronic
1119994544 14:79238830-79238852 CTTTCTCTGGATCTGTTGCTAGG - Intronic
1121248733 14:92483845-92483867 CCTTCTCTGCTGCTGGTGTCAGG - Intronic
1121685913 14:95834939-95834961 GCTTCTCTGCACCTGCTGGAGGG + Intergenic
1122944007 14:104996828-104996850 ACTTCTCTGCAGCTGTAGTTAGG - Intronic
1123200751 14:106661574-106661596 ACTCCTCTGCAGCTGCTCCAGGG + Intergenic
1124886485 15:33692204-33692226 GCTGCTCTGCTGCTGATGCACGG + Intronic
1128511506 15:68316448-68316470 CCTTCTCTGCAGGAGTGGCTGGG + Intronic
1129468589 15:75738122-75738144 CCTTCTTTCCAGCACTTGCATGG - Intergenic
1129726991 15:77906385-77906407 CCTTCTTTCCAGCACTTGCATGG + Intergenic
1130485955 15:84398703-84398725 CCTTCTGTCCAGCACTTGCATGG - Intergenic
1130561621 15:84963574-84963596 GCTTCTCTTCAGCTCTGGCATGG + Intergenic
1130919193 15:88330005-88330027 CCTTCTCTGCATCATCTGCAGGG - Intergenic
1131612703 15:93981833-93981855 CTTTCTCTGCAGCTCTGACAGGG - Intergenic
1132157666 15:99507793-99507815 CCTTTTCTGGAGCTGCTACAAGG - Intergenic
1132457157 16:30265-30287 CAGTCTCTGCAGCTGCTGAAAGG - Intergenic
1135185239 16:20309987-20310009 CCTTATCTGTAGCTGTGGGAAGG + Intronic
1135643824 16:24143912-24143934 CCTTTTCTGATTCTGTTGCAGGG + Intronic
1138178220 16:54922969-54922991 CTTACTTTGCAGCTGTTGCAGGG - Intergenic
1139217455 16:65141873-65141895 TCTTCTCTCCACCTGCTGCAAGG - Intergenic
1139427813 16:66894138-66894160 CCTTCTGTTCATCTGTTGCAGGG - Intronic
1139492458 16:67293676-67293698 CCTTCTCTGAGGCTGTGGAATGG + Exonic
1139636799 16:68263186-68263208 CCTTATATGAAGCTGTGGCAGGG + Intergenic
1141044145 16:80700893-80700915 CCTGCTCTGTTGCTGTGGCAGGG - Intronic
1141063611 16:80896904-80896926 CCTTGTCCCCAGCTGTGGCAAGG + Intergenic
1141710449 16:85695838-85695860 CTTTTCCTGGAGCTGTTGCAAGG + Intronic
1142784873 17:2213343-2213365 CCTTCTCTGAAGCTGCTGCTTGG - Intronic
1143225376 17:5297745-5297767 CCTTCTCTCCATCTGTAACAAGG - Intronic
1143678612 17:8458200-8458222 CCTTCTCTGATGCTGTTTCATGG + Intronic
1145906910 17:28521390-28521412 CCTTCTCAGGAGGTGGTGCAGGG - Intronic
1150470265 17:65431290-65431312 CCTCCTCTGCAGCAGGGGCATGG + Intergenic
1151403242 17:73869883-73869905 CCTTCTCTGCTGCTCTGGGAGGG + Intergenic
1152595094 17:81234038-81234060 TCTGTTCTGCAGCTTTTGCAGGG - Exonic
1152961143 18:80786-80808 CAGTCTCTGCAGCTGCTGAAAGG - Intergenic
1154323464 18:13372660-13372682 CCTTCCCTGAAGCTGTGGAATGG + Intronic
1156197668 18:34793917-34793939 ACATGTGTGCAGCTGTTGCAGGG - Intronic
1157985358 18:52431660-52431682 CCTTCACTGTACTTGTTGCAGGG - Intronic
1159108243 18:64027487-64027509 CCATTTCTCCAGCTGCTGCACGG - Intergenic
1159985162 18:74833204-74833226 CTCTCTTAGCAGCTGTTGCAGGG + Intronic
1160060648 18:75526177-75526199 GGTTCTCAGCATCTGTTGCAGGG + Intergenic
1160330039 18:77983048-77983070 ACTTTTCCGCAGCTGTTGCCTGG + Intergenic
1160336976 18:78050998-78051020 CCTTCTCTGCACGTGTTTCATGG - Intergenic
1161330233 19:3683414-3683436 CCTGCGCTCCAGCTGTTCCAGGG - Intronic
1162569888 19:11465719-11465741 CCTTCTCAGCAGCTGCAGCTGGG - Intronic
1163325245 19:16599481-16599503 TCTTCCCTGCAGCTGTTCCTGGG - Intronic
1165278877 19:34780084-34780106 TATTCTCTGCATCTGTTGCTGGG + Intergenic
1166685189 19:44792481-44792503 CCTGCTCTGCAGCTGCTGCCTGG + Exonic
1167829592 19:52008487-52008509 CCTTCTATTCAGCTGCTGAAAGG - Intergenic
925110559 2:1332011-1332033 TCTTCCCTCCAGCTGTTCCAAGG + Intronic
925200961 2:1967643-1967665 CCTTCTGCGCAGCTGCAGCAGGG + Intronic
925449533 2:3956969-3956991 CCTGCTCTGCAGCAGCTGGAGGG - Intergenic
925556310 2:5134691-5134713 CCTTTTCTGACTCTGTTGCAGGG + Intergenic
925836447 2:7951357-7951379 CCTTCTCTGGAGCTGTTTTTAGG + Intergenic
926710624 2:15876677-15876699 CCTGCTCTGCATCTGTGGCATGG - Intergenic
926728447 2:16016115-16016137 CATTCACTGCAGGTCTTGCATGG + Intergenic
926841727 2:17088682-17088704 CCACCTCTCCAGCTGTGGCAGGG - Intergenic
927149168 2:20185944-20185966 CCATCTCTGCGGGTGCTGCAGGG + Intergenic
927484237 2:23477922-23477944 TCTTCCCTGCTGCTGATGCAGGG + Intronic
927486160 2:23489722-23489744 CCCTCTCCCCAGCTGTTGCAGGG - Intronic
928312102 2:30219794-30219816 GCTTCTCTGCAGCAGCTGCCTGG - Intergenic
930854249 2:55995526-55995548 AGTTCTCTGCAGTTGTTGCTTGG + Intergenic
931067154 2:58599779-58599801 CCATCTCTGCATCTCTTACAGGG - Intergenic
932633968 2:73371730-73371752 CCTGCCCTGCAGAGGTTGCAAGG - Intergenic
932758553 2:74425085-74425107 CCCTCTGTGCAGCTGTGGCAGGG + Exonic
933593345 2:84257886-84257908 GCTGCTCTGCAGCTGTATCAGGG + Intergenic
933729455 2:85446082-85446104 CCAGCCCTGCAGCTGATGCAAGG + Intergenic
933994630 2:87659152-87659174 GGTTCACTGCAGCTGGTGCAGGG + Intergenic
936110328 2:109659589-109659611 TCTGCTCAGCAGCTGCTGCAGGG - Intergenic
936299226 2:111291761-111291783 GGTTCACTGCAGCTGGTGCAGGG - Intergenic
936431543 2:112468469-112468491 CATTCTTTGTAGCTATTGCATGG - Intergenic
937262164 2:120593633-120593655 CCTGCTCTGAATCAGTTGCAAGG - Intergenic
937361059 2:121230490-121230512 GCTTCACTTCAGCTGGTGCAGGG + Intronic
937718199 2:125059444-125059466 CCTTCACTGCACCAGTTTCATGG + Intergenic
939773970 2:146361363-146361385 CCTATTCTACAGCAGTTGCAGGG - Intergenic
940120021 2:150253938-150253960 CCTTATATGCAGCTCTTCCAGGG - Intergenic
940361113 2:152797159-152797181 TCTTCTCTGCAGGGGATGCAGGG + Intergenic
941798042 2:169623132-169623154 CCATCTCTGCATCTGCTGGAAGG - Intronic
942171134 2:173290743-173290765 CCTGCTCTGCAGCTGCTGAGTGG - Intergenic
943247302 2:185472853-185472875 CCAGGTCTGAAGCTGTTGCAGGG - Intergenic
943400352 2:187401882-187401904 CCTTCTATGGAGCTATTACATGG + Intronic
944910608 2:204306820-204306842 TCTTCTCTGCAGTAGTTGCAGGG - Intergenic
945873357 2:215251376-215251398 CCGTCTCTGCAAATGTTTCATGG - Intergenic
948034698 2:234848534-234848556 CCTTCTCAGCAGCTGCAGCAGGG + Intergenic
948768598 2:240235998-240236020 CCATCACTGCAGCTGTGGCCAGG - Intergenic
1169046940 20:2540775-2540797 ACTGCTCTGCAGCTGCTACAAGG - Intronic
1169100002 20:2939366-2939388 CATTCTCTGCAGCTGTAACATGG + Intronic
1169226700 20:3861424-3861446 TTCTCTCTGCAGCTGTTGTAGGG - Exonic
1170769550 20:19320001-19320023 ACTTCTCAGCAGCTGCAGCATGG + Intronic
1172112767 20:32557046-32557068 ACTTTTCTGCAGCTGTTACAGGG + Intronic
1173186590 20:40844895-40844917 CCTTCTCTGCAGAAGTTTCTGGG - Intergenic
1173194764 20:40905179-40905201 CCTTCTCTACAGCCTCTGCAGGG - Intergenic
1173793740 20:45844306-45844328 CATTCTCTGCAGCTGGCTCAGGG + Exonic
1174001849 20:47380496-47380518 CCTTCTCTGCTCCTGTTACGTGG - Intergenic
1174124083 20:48289853-48289875 CCTCCTCTGCAGAGGCTGCAGGG - Intergenic
1174467710 20:50730774-50730796 CCGCCTCTGCAGCGGTTGCTGGG - Intergenic
1174928948 20:54792731-54792753 CCTTATCTGCATCTCTTTCAGGG + Intergenic
1175485209 20:59340841-59340863 CCTTCTCTGCAGTTCTTGTGAGG + Intergenic
1175554244 20:59836525-59836547 TCTTCTCTCCAGCTCTTCCACGG - Exonic
1178430163 21:32511879-32511901 CCTGCTCTCCTGCTGTTGCCAGG - Intronic
1178663189 21:34523594-34523616 CCTTCTCCGCAGCAGATGCCAGG - Exonic
1179288096 21:39995334-39995356 CCATCTCTGCAGCCGTTGCTGGG - Intergenic
1179460671 21:41532790-41532812 CTTTCTCTCCTGCTGTTGCTAGG + Intergenic
1181512432 22:23394900-23394922 CCTTCTCTGCAGCTCCTGGCAGG - Intergenic
1182148934 22:28014938-28014960 CCCACTCTGCAGCTGCTGCCTGG - Intronic
1182505631 22:30780322-30780344 ACTCCTCAGCAGCTGTGGCATGG - Intronic
1182933160 22:34194286-34194308 ACTTCTCTGCAGCTTTCACACGG - Intergenic
1184785962 22:46672161-46672183 CCATCCCTGCATCTGTTGCCAGG + Intronic
1185171578 22:49297581-49297603 CCTTCTCTGCAGGGGGTGCCTGG - Intergenic
1203278600 22_KI270734v1_random:110138-110160 CCTCCTCTGCACCCCTTGCAGGG - Intergenic
950898548 3:16475570-16475592 TCTTCTCTGCCCCTGTTGTATGG - Intronic
951378397 3:21951877-21951899 CCATTTCTGCAGCACTTGCATGG + Intronic
951544087 3:23807818-23807840 CCTTCTCCTCACCTGTTGCATGG + Intronic
952594812 3:35004098-35004120 CCATCTATCCAGCTGTTACAAGG + Intergenic
952748956 3:36808760-36808782 TCTTCTTTGCAGCTGTTGTCAGG - Intergenic
952923509 3:38305437-38305459 CCCTCCTTGCTGCTGTTGCAAGG + Intronic
954534410 3:51348173-51348195 CCTTCTCTCAGGCTGTTGCATGG + Intronic
955045770 3:55358204-55358226 CCCTCTCTGCTGCTCCTGCATGG - Intergenic
956355616 3:68389607-68389629 CCTTCTCTGCTGTTGTTGCTGGG - Intronic
958733187 3:97980005-97980027 CCTTCTCTGCATCTGTGTCTAGG + Intergenic
959128444 3:102320035-102320057 CCTTTTCTGCATCTGTTGAGAGG + Intronic
959580094 3:107974519-107974541 CCCTCTCTGGAGATGTTTCAAGG + Intergenic
959744382 3:109759632-109759654 CCTTCTTTGCAGATGCTGCTGGG - Intergenic
960830459 3:121840936-121840958 TCTTCTCTGAAGCTATTTCAGGG - Intronic
960851095 3:122055401-122055423 GCTTCTCTGCTGCTGTAACAGGG + Exonic
961244763 3:125441466-125441488 GCTTTTCTGGGGCTGTTGCAAGG + Intergenic
962237696 3:133721549-133721571 CATACTTTGCAGCTGTTGGATGG + Intergenic
962813064 3:138975253-138975275 CCTTCTCTCCAGCTCTTGACAGG + Intergenic
966222212 3:177562039-177562061 CCTGCCCTGCAGCTCTTTCAGGG - Intergenic
967731849 3:192914412-192914434 CCTTTTCTGCATCTGTTCAATGG + Intronic
968494897 4:910141-910163 TCTTCTCTGCAGCTGTGCCTGGG - Intronic
969326900 4:6449315-6449337 TGTTCTCTGCAGCTGCCGCAGGG - Intronic
969567937 4:7991200-7991222 CCTTCTCTGCAGATGCTGAGAGG + Intronic
972316888 4:37935024-37935046 CCTTCTGTGCAGGTGCTCCAAGG - Intronic
974990788 4:69086440-69086462 CATACTCTGCAGCTGTTGGATGG + Intronic
975118846 4:70706507-70706529 CCTTCTCTTAAGCTGTTACTTGG - Intronic
975148733 4:70998056-70998078 ACTTCCCTGCAGCTGTTGTGAGG - Exonic
977005433 4:91563432-91563454 CTTTTTCTGCATCTGTTGAAAGG - Intronic
977967588 4:103171201-103171223 TGTTTTCTGCAGCTGTTGAATGG - Intronic
981276643 4:142906686-142906708 TGTATTCTGCAGCTGTTGCATGG + Intergenic
981538833 4:145827275-145827297 CCTTTTCTCCATTTGTTGCAAGG - Intronic
983296794 4:165876392-165876414 CCTTCTCTTTTGCTTTTGCATGG - Intronic
983752552 4:171294261-171294283 ATTTATCTGCAGCTTTTGCATGG + Intergenic
985171830 4:187158221-187158243 CCTTCTCTGCAGCTCCTCAACGG + Intergenic
985728265 5:1526855-1526877 CCTTCTCTGCTGCAGCTGGAAGG + Intergenic
986480745 5:8184587-8184609 CCTTCTCTGCACCTGTGTAATGG - Intergenic
987741976 5:21920948-21920970 CCTCCTCTGCAGCAGATGCTTGG + Intronic
989137430 5:38168709-38168731 CCTTCTCTGCACCTGTTTCAAGG + Intergenic
989268703 5:39506703-39506725 GCTTCTATGCAGCTGATGGAGGG - Intergenic
989621463 5:43388444-43388466 CATTGCCTCCAGCTGTTGCACGG - Exonic
990711146 5:58582172-58582194 CTTTCTCTGCAGCTGCAGCTTGG + Intergenic
992141156 5:73798535-73798557 CATTCTCTGCAGATGCTGTAAGG + Intronic
992549800 5:77849714-77849736 CCTTCTCTGGAGAGGGTGCAGGG + Intronic
994139579 5:96326947-96326969 CCTTCTCTGGAACGGTTGAAGGG + Intergenic
995530209 5:113085006-113085028 CCTTCTATGCAGGAGCTGCAAGG - Intronic
996029994 5:118694013-118694035 CCTTCTTTGAAGCATTTGCATGG + Intergenic
996510651 5:124312269-124312291 CGTTCTCTGGAGCTGAAGCATGG - Intergenic
997293829 5:132757280-132757302 CCTGCTCTGCTGCTGGAGCATGG + Intronic
997674215 5:135700780-135700802 CCATGTCTGCAGCTCTAGCAGGG + Intergenic
997899943 5:137754786-137754808 CGTTTTCGGCAGCTGTTGGACGG + Intergenic
998551525 5:143082058-143082080 CTTTCTCTGGATCTGTTGCTGGG + Intronic
998587559 5:143443408-143443430 CCTCCTCAGCTGCTGTGGCAGGG + Intergenic
999986013 5:157006150-157006172 TCATCTCTGCAGGCGTTGCATGG + Intergenic
1001542214 5:172547596-172547618 CCATGTCTGCACCTGTAGCATGG - Intergenic
1002919541 6:1557039-1557061 CATTCTCTATAGCTGCTGCATGG + Intergenic
1002987250 6:2202534-2202556 CCTCCTCTGCAACTGAGGCACGG - Intronic
1003533953 6:6959804-6959826 CCTTCTCTAGGGCGGTTGCATGG - Intergenic
1004273033 6:14211804-14211826 CCTGCTCTGCAGCTGTCCCCAGG + Intergenic
1005787237 6:29257052-29257074 CCTTCTATGCCACTGTTCCAAGG + Intergenic
1007595337 6:43047639-43047661 ACTTCTCTGTAGCTCTTGCAGGG + Intronic
1008508683 6:52255959-52255981 CCCTCTCTCCAGCTCTTTCAGGG + Intergenic
1009318504 6:62255486-62255508 CCTGCTCTGCAGCTAGTGCATGG - Intronic
1010121213 6:72378031-72378053 CCTGCTCTGCTGTTGTTTCAAGG + Intronic
1011245890 6:85320958-85320980 CCTTCTCTGCAGCTGACCCTGGG - Intergenic
1013909980 6:115263413-115263435 CCTTCAATGCTGCTGTAGCAGGG - Intergenic
1014004729 6:116405215-116405237 AGTTCTCTGCAGCTGTTTCTCGG + Intronic
1015226411 6:130862009-130862031 CCTTAACTGCTGCTGTTGCAAGG - Intronic
1015254535 6:131163014-131163036 CTCTCTCTGCTGCTGTTTCATGG + Intronic
1015395088 6:132724846-132724868 CCTACCCTGCAGCTGTTGACTGG - Exonic
1016116362 6:140290661-140290683 CCCTTCCTGCTGCTGTTGCAGGG + Intergenic
1018598703 6:165514707-165514729 GCTTCTCTTCTGCAGTTGCAGGG - Intronic
1018724871 6:166604080-166604102 CCTTCTCTGGAGCTTTTCCATGG - Intronic
1019191803 6:170255714-170255736 CCTTCTCTGCAGTGGTCACAGGG + Intergenic
1019206495 6:170366148-170366170 GTTTCTCTGCAGCTGTTGGGAGG + Intronic
1022478138 7:30725280-30725302 CCTCCTCTGGAGCTTTTGGAGGG + Intronic
1023573826 7:41603271-41603293 CCTTCTCTCCAGAAATTGCATGG + Intergenic
1025936254 7:66040054-66040076 ACTGCTCTGAAGCTGTTCCAAGG + Intergenic
1026231891 7:68491093-68491115 TCTGCTTTGCAGCTGTTGGAAGG - Intergenic
1029275698 7:99402923-99402945 CCTCCTGTGTAGCTGTTGAAGGG - Intronic
1031424087 7:121584797-121584819 CATTCTCTCCAGCTCTTGCCTGG + Intergenic
1032153592 7:129450760-129450782 CCTTCTCTGCAGCCTATACAGGG + Intronic
1032153870 7:129452699-129452721 CCTTCTCTGCAGCCCATACAGGG + Intronic
1033148759 7:138894516-138894538 CCTTGTCTGCAGCTGTCGACAGG - Exonic
1033488645 7:141817809-141817831 CCTTGACTGCAGCTGTTTGAGGG + Intergenic
1034892076 7:154849898-154849920 CTTTTTCTGCATCTATTGCAAGG + Intronic
1035285572 7:157804465-157804487 CATTCTCTGGAGCAGCTGCATGG - Intronic
1035373395 7:158393038-158393060 CCTTCTCTGCAGCAGGCACAGGG - Intronic
1035603899 8:916403-916425 CATTCTCAGCAACTATTGCAAGG + Intergenic
1036589347 8:10153770-10153792 TTTTTTCTGAAGCTGTTGCACGG - Intronic
1038493744 8:27987620-27987642 CCTTCTCTGCAGCTGTTGCAGGG - Exonic
1039221768 8:35339609-35339631 CCTTGTGTGCTGCTGCTGCATGG + Intronic
1039555806 8:38474063-38474085 CCTTTTCTGCAGCTGGTGTTGGG - Intergenic
1039605195 8:38874775-38874797 CCTTTTCAGCAGCTGCTGCTCGG - Intergenic
1041795859 8:61747239-61747261 CCTTCTCTGCAGCTGCAGGTAGG - Intergenic
1042185717 8:66134795-66134817 GCTTCCCTGCAGGTGTAGCAGGG - Intronic
1042203715 8:66307125-66307147 CCTTCCTTGCAGCTGGTGAATGG + Intergenic
1042550603 8:69991053-69991075 CCATCTCTGTAGCTGTTGCAGGG - Intergenic
1043087267 8:75849907-75849929 TCATCTCTGCAGCTGTGGCTGGG - Intergenic
1043257687 8:78156887-78156909 CCTTCTCTGAGGCAGTTGCCAGG + Intergenic
1045053029 8:98343812-98343834 CATTCTCTGCTGCGGTAGCAAGG + Intergenic
1047773248 8:128047538-128047560 TCTTCACTGCAGCAGTAGCAAGG - Intergenic
1048029379 8:130616573-130616595 CATACTCTTCAGCTGTGGCAGGG - Intergenic
1048867516 8:138771739-138771761 TCTTCTCTGAAGCCGTTGGAAGG - Intronic
1049920856 9:362808-362830 CCTACTCTTCATCTGGTGCAAGG - Intronic
1050019544 9:1268993-1269015 CCCTCTCTGCAGCTGCTCTAAGG + Intergenic
1050161524 9:2724601-2724623 GCCTCTGTGTAGCTGTTGCAAGG + Intronic
1052721885 9:32181708-32181730 ACTACTCTTCATCTGTTGCAAGG + Intergenic
1052999007 9:34567055-34567077 CCATCTTTGGAGCAGTTGCATGG - Intronic
1055636366 9:78282891-78282913 CCTTCTCTGCCTCTGTTGCAAGG + Intergenic
1056559500 9:87717864-87717886 ACTTCTCTGCATCACTTGCATGG - Intergenic
1056766714 9:89448589-89448611 CCTTCTCTGCTGCCGTTGTGTGG - Intronic
1056836822 9:89962273-89962295 CCACCGCTGCAGCTGTTGCTGGG + Intergenic
1056846838 9:90045725-90045747 CATTCTTTGCAGATGTTGGATGG + Intergenic
1056852009 9:90092971-90092993 CCTCCTCTGCTGCTGGTCCATGG - Intergenic
1056971097 9:91204315-91204337 CCTTTTCTGCATCTATTGAAAGG - Intergenic
1059432201 9:114257069-114257091 CCTCCACAGCAGCTGTTGGAGGG + Intronic
1059795793 9:117695105-117695127 CCTTCTCTGTACTAGTTGCAAGG - Intergenic
1060268921 9:122127801-122127823 CCCTCTCTGCAGTTCTTGCCAGG - Intergenic
1060471596 9:123952540-123952562 CCTGCAGTGCAGCTCTTGCAGGG + Intergenic
1060964819 9:127706630-127706652 CCTGTTCTGCAGCTGTGGCCTGG - Intronic
1061061213 9:128251190-128251212 CCTTCTTTCCAGCACTTGCATGG + Intronic
1061781487 9:132999056-132999078 CCTTCTTAGCAGCTGGGGCAGGG + Intergenic
1061972717 9:134053580-134053602 CCTCCTCTGCAGCTGTCGCCTGG - Exonic
1062140688 9:134956298-134956320 CATTCTCTGAAGTTGTTGGAGGG - Intergenic
1062183415 9:135203210-135203232 CCTGGTCTGTAGCTGTTGGAGGG + Intergenic
1062570765 9:137184146-137184168 CCTTCGCTGTCGCTCTTGCAGGG - Intronic
1062737016 9:138143200-138143222 CAGTCTCTGCAGCTGCTGAAAGG + Intergenic
1186486931 X:9940773-9940795 CCTGCTCTGTAGCTGCTTCAGGG + Intronic
1186551689 X:10512641-10512663 CCATCTTTGCAGGTGTTGGAAGG - Intronic
1187276789 X:17823410-17823432 TCTTCTCAGCAGCTTTTCCATGG + Intronic
1188440921 X:30215002-30215024 CCCCCTCTGCTGGTGTTGCAAGG - Intergenic
1189172732 X:38925238-38925260 CCTTCTCAGTAGCTGATGAAGGG - Intergenic
1195011498 X:100736266-100736288 CCTTCTTTGCAGGTGGTGCTTGG + Intergenic
1197087992 X:122501915-122501937 CCTTCTCTGGAGCTGTACTATGG + Intergenic
1198026408 X:132711987-132712009 CCTTCTCTCTAGCTGTTATATGG - Intronic
1198275287 X:135093941-135093963 CCTTCCCTTCCTCTGTTGCAAGG + Intergenic
1199188184 X:144940221-144940243 CCTTGCCTGCTGCCGTTGCAGGG - Intergenic
1199664791 X:150088159-150088181 CCTTCTCAGCAGCTTTTGAAAGG - Intergenic
1200129252 X:153831974-153831996 CGGTCTCTGCAGCTGGTGGATGG + Intergenic
1200399202 X:156009461-156009483 CAGTCTCTGCAGCTGCTGAAAGG + Intronic
1202176537 Y:22103770-22103792 CCTTGTTTGTGGCTGTTGCAGGG + Intergenic
1202214824 Y:22482614-22482636 CCTTGTTTGTGGCTGTTGCAGGG - Intergenic