ID: 1038497039

View in Genome Browser
Species Human (GRCh38)
Location 8:28010888-28010910
Sequence ACACCCTGTAACCACCTGAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1038497039_1038497043 -4 Left 1038497039 8:28010888-28010910 CCCATCAGGTGGTTACAGGGTGT No data
Right 1038497043 8:28010907-28010929 GTGTCTTCCCATCAGGCCATGGG No data
1038497039_1038497046 1 Left 1038497039 8:28010888-28010910 CCCATCAGGTGGTTACAGGGTGT No data
Right 1038497046 8:28010912-28010934 TTCCCATCAGGCCATGGGGGTGG No data
1038497039_1038497044 -3 Left 1038497039 8:28010888-28010910 CCCATCAGGTGGTTACAGGGTGT No data
Right 1038497044 8:28010908-28010930 TGTCTTCCCATCAGGCCATGGGG No data
1038497039_1038497049 3 Left 1038497039 8:28010888-28010910 CCCATCAGGTGGTTACAGGGTGT No data
Right 1038497049 8:28010914-28010936 CCCATCAGGCCATGGGGGTGGGG No data
1038497039_1038497045 -2 Left 1038497039 8:28010888-28010910 CCCATCAGGTGGTTACAGGGTGT No data
Right 1038497045 8:28010909-28010931 GTCTTCCCATCAGGCCATGGGGG No data
1038497039_1038497042 -5 Left 1038497039 8:28010888-28010910 CCCATCAGGTGGTTACAGGGTGT No data
Right 1038497042 8:28010906-28010928 GGTGTCTTCCCATCAGGCCATGG No data
1038497039_1038497047 2 Left 1038497039 8:28010888-28010910 CCCATCAGGTGGTTACAGGGTGT No data
Right 1038497047 8:28010913-28010935 TCCCATCAGGCCATGGGGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1038497039 Original CRISPR ACACCCTGTAACCACCTGAT GGG (reversed) Intergenic
No off target data available for this crispr