ID: 1038506956

View in Genome Browser
Species Human (GRCh38)
Location 8:28092798-28092820
Sequence TCCCCGGATGTGACGACCCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 41
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 38}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1038506946_1038506956 0 Left 1038506946 8:28092775-28092797 CCCATTCGCGTTCCCACCCACCC 0: 1
1: 0
2: 0
3: 6
4: 158
Right 1038506956 8:28092798-28092820 TCCCCGGATGTGACGACCCTGGG 0: 1
1: 0
2: 0
3: 2
4: 38
1038506943_1038506956 17 Left 1038506943 8:28092758-28092780 CCTCCTCCGTGGTCTCGCCCATT 0: 1
1: 0
2: 2
3: 10
4: 88
Right 1038506956 8:28092798-28092820 TCCCCGGATGTGACGACCCTGGG 0: 1
1: 0
2: 0
3: 2
4: 38
1038506945_1038506956 11 Left 1038506945 8:28092764-28092786 CCGTGGTCTCGCCCATTCGCGTT 0: 1
1: 0
2: 0
3: 0
4: 26
Right 1038506956 8:28092798-28092820 TCCCCGGATGTGACGACCCTGGG 0: 1
1: 0
2: 0
3: 2
4: 38
1038506947_1038506956 -1 Left 1038506947 8:28092776-28092798 CCATTCGCGTTCCCACCCACCCT 0: 1
1: 0
2: 0
3: 9
4: 231
Right 1038506956 8:28092798-28092820 TCCCCGGATGTGACGACCCTGGG 0: 1
1: 0
2: 0
3: 2
4: 38
1038506944_1038506956 14 Left 1038506944 8:28092761-28092783 CCTCCGTGGTCTCGCCCATTCGC 0: 1
1: 0
2: 0
3: 3
4: 35
Right 1038506956 8:28092798-28092820 TCCCCGGATGTGACGACCCTGGG 0: 1
1: 0
2: 0
3: 2
4: 38

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1038506956 Original CRISPR TCCCCGGATGTGACGACCCT GGG Intronic
900390996 1:2433856-2433878 TCCACGGATGTGCCCACACTGGG + Intronic
903292495 1:22323619-22323641 TCCCCTGAAATGACAACCCTGGG + Intergenic
915289917 1:154876658-154876680 TCCCTGGATGTCTAGACCCTGGG + Intergenic
1065101260 10:22335177-22335199 TCCCCGGACAAGGCGACCCTGGG + Intergenic
1067105340 10:43362560-43362582 TCCCCGGCAGCGACGACCCTCGG - Intergenic
1083299512 11:61732937-61732959 ACCCCGGATGGGAGGGCCCTGGG - Intronic
1083915451 11:65740274-65740296 TCCCCTGTTGTGTTGACCCTGGG - Intergenic
1084261798 11:67983994-67984016 CCCCCGGATATGACGATCCACGG - Intergenic
1087425073 11:97975276-97975298 TCCACTGATGTGGCTACCCTCGG + Intergenic
1090127428 11:124102031-124102053 TCCATGAATGTGACTACCCTAGG + Intergenic
1090363976 11:126191157-126191179 CCTCAGAATGTGACGACCCTTGG + Intergenic
1112583459 13:100696113-100696135 TCCCCTGTTGTGTTGACCCTGGG - Intergenic
1113853173 13:113429371-113429393 TCTCCGGATGTGACTGCTCTGGG + Intronic
1115766349 14:36627037-36627059 TGCCCGGAGGTGAGGACCATTGG + Intergenic
1124368208 15:29088784-29088806 TGGCCAGATGTGAGGACCCTGGG - Intronic
1137777987 16:51072263-51072285 TCCCTGGGTGTGAGGACCCTAGG - Intergenic
1139785059 16:69385893-69385915 TCCTCGGCTGTGACGCCGCTGGG + Exonic
1140801351 16:78491302-78491324 CCCCTGGATGAGACGCCCCTTGG + Intronic
1158329806 18:56349405-56349427 ACCCTGTATGTGAAGACCCTGGG - Intergenic
938574709 2:132593173-132593195 TCCCCAGTTGCCACGACCCTTGG - Intronic
1172233089 20:33350307-33350329 TCACTGGATGTTACAACCCTGGG - Intergenic
1180106014 21:45618590-45618612 TCCCAGGATGTGAGGCCCCCAGG - Intergenic
1182516066 22:30859822-30859844 TCCCGAGATGTCAGGACCCTGGG + Intronic
1183156994 22:36083280-36083302 TCCCCTGCTGCGATGACCCTGGG + Intergenic
950675841 3:14554000-14554022 GCCCCAGATGTGACTGCCCTGGG + Intergenic
967389691 3:188943372-188943394 TCCCCGGATGTGTCCTCTCTCGG - Intergenic
982649561 4:158070282-158070304 TCCAAGGATGTGAAGACACTGGG + Intergenic
985700643 5:1369913-1369935 TCCCCTGTTGTGCTGACCCTAGG + Intergenic
995072563 5:107941489-107941511 TCCTCGGATGTGAAGCCACTAGG + Intronic
1007703635 6:43778389-43778411 TACCCAGATGGGACAACCCTGGG - Intronic
1017786577 6:157761849-157761871 TCCCCAGATGTGCTGGCCCTGGG - Intronic
1018784719 6:167099025-167099047 TCCCAGGATGTGAGGACTGTGGG - Intergenic
1019923332 7:4176688-4176710 TCGACGGATTTGACGACTCTGGG + Intronic
1038499982 8:28035728-28035750 TACCCAGAGGTGAGGACCCTTGG + Intronic
1038506956 8:28092798-28092820 TCCCCGGATGTGACGACCCTGGG + Intronic
1057355566 9:94328461-94328483 TCCCCAGGTGTGATGTCCCTGGG + Intronic
1060207589 9:121691309-121691331 TCCCCGGATGTCCCCACACTAGG - Intronic
1062066750 9:134532316-134532338 TCCGCTGATGTGAAGAGCCTTGG + Intergenic
1185531189 X:820429-820451 CCCCCGGATGAGACGTCCGTTGG + Intergenic
1192386401 X:70675946-70675968 TCCACGGATTTGACTACTCTAGG + Intronic
1195877588 X:109558134-109558156 TGCCAGGATGTGAAGACTCTAGG - Intergenic