ID: 1038516986

View in Genome Browser
Species Human (GRCh38)
Location 8:28195710-28195732
Sequence GACCATCATGGGGCAATACC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1038516986_1038516997 24 Left 1038516986 8:28195710-28195732 CCTGGTATTGCCCCATGATGGTC No data
Right 1038516997 8:28195757-28195779 CATTTTACAAATGAGAAACTCGG No data
1038516986_1038516998 25 Left 1038516986 8:28195710-28195732 CCTGGTATTGCCCCATGATGGTC No data
Right 1038516998 8:28195758-28195780 ATTTTACAAATGAGAAACTCGGG No data
1038516986_1038516994 -3 Left 1038516986 8:28195710-28195732 CCTGGTATTGCCCCATGATGGTC No data
Right 1038516994 8:28195730-28195752 GTCCTCGGAGGGAGGAATTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1038516986 Original CRISPR GACCATCATGGGGCAATACC AGG (reversed) Intergenic