ID: 1038516990 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 8:28195720-28195742 |
| Sequence | TCCCTCCGAGGACCATCATG GGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1038516990_1038516998 | 15 | Left | 1038516990 | 8:28195720-28195742 | CCCCATGATGGTCCTCGGAGGGA | No data | ||
| Right | 1038516998 | 8:28195758-28195780 | ATTTTACAAATGAGAAACTCGGG | No data | ||||
| 1038516990_1038516997 | 14 | Left | 1038516990 | 8:28195720-28195742 | CCCCATGATGGTCCTCGGAGGGA | No data | ||
| Right | 1038516997 | 8:28195757-28195779 | CATTTTACAAATGAGAAACTCGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1038516990 | Original CRISPR | TCCCTCCGAGGACCATCATG GGG (reversed) | Intergenic | ||