ID: 1038516990

View in Genome Browser
Species Human (GRCh38)
Location 8:28195720-28195742
Sequence TCCCTCCGAGGACCATCATG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1038516990_1038516998 15 Left 1038516990 8:28195720-28195742 CCCCATGATGGTCCTCGGAGGGA No data
Right 1038516998 8:28195758-28195780 ATTTTACAAATGAGAAACTCGGG No data
1038516990_1038516997 14 Left 1038516990 8:28195720-28195742 CCCCATGATGGTCCTCGGAGGGA No data
Right 1038516997 8:28195757-28195779 CATTTTACAAATGAGAAACTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1038516990 Original CRISPR TCCCTCCGAGGACCATCATG GGG (reversed) Intergenic