ID: 1038516991

View in Genome Browser
Species Human (GRCh38)
Location 8:28195721-28195743
Sequence CTCCCTCCGAGGACCATCAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1038516991_1038516997 13 Left 1038516991 8:28195721-28195743 CCCATGATGGTCCTCGGAGGGAG No data
Right 1038516997 8:28195757-28195779 CATTTTACAAATGAGAAACTCGG No data
1038516991_1038516998 14 Left 1038516991 8:28195721-28195743 CCCATGATGGTCCTCGGAGGGAG No data
Right 1038516998 8:28195758-28195780 ATTTTACAAATGAGAAACTCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1038516991 Original CRISPR CTCCCTCCGAGGACCATCAT GGG (reversed) Intergenic