ID: 1038516992

View in Genome Browser
Species Human (GRCh38)
Location 8:28195722-28195744
Sequence CCTCCCTCCGAGGACCATCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1038516992_1038516998 13 Left 1038516992 8:28195722-28195744 CCATGATGGTCCTCGGAGGGAGG No data
Right 1038516998 8:28195758-28195780 ATTTTACAAATGAGAAACTCGGG No data
1038516992_1038516997 12 Left 1038516992 8:28195722-28195744 CCATGATGGTCCTCGGAGGGAGG No data
Right 1038516997 8:28195757-28195779 CATTTTACAAATGAGAAACTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1038516992 Original CRISPR CCTCCCTCCGAGGACCATCA TGG (reversed) Intergenic