ID: 1038516998

View in Genome Browser
Species Human (GRCh38)
Location 8:28195758-28195780
Sequence ATTTTACAAATGAGAAACTC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1038516986_1038516998 25 Left 1038516986 8:28195710-28195732 CCTGGTATTGCCCCATGATGGTC No data
Right 1038516998 8:28195758-28195780 ATTTTACAAATGAGAAACTCGGG No data
1038516991_1038516998 14 Left 1038516991 8:28195721-28195743 CCCATGATGGTCCTCGGAGGGAG No data
Right 1038516998 8:28195758-28195780 ATTTTACAAATGAGAAACTCGGG No data
1038516995_1038516998 3 Left 1038516995 8:28195732-28195754 CCTCGGAGGGAGGAATTAAGGTC No data
Right 1038516998 8:28195758-28195780 ATTTTACAAATGAGAAACTCGGG No data
1038516992_1038516998 13 Left 1038516992 8:28195722-28195744 CCATGATGGTCCTCGGAGGGAGG No data
Right 1038516998 8:28195758-28195780 ATTTTACAAATGAGAAACTCGGG No data
1038516990_1038516998 15 Left 1038516990 8:28195720-28195742 CCCCATGATGGTCCTCGGAGGGA No data
Right 1038516998 8:28195758-28195780 ATTTTACAAATGAGAAACTCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1038516998 Original CRISPR ATTTTACAAATGAGAAACTC GGG Intergenic