ID: 1038523913

View in Genome Browser
Species Human (GRCh38)
Location 8:28257119-28257141
Sequence TCCTCTCTCGGGTTTAGAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1038523906_1038523913 -3 Left 1038523906 8:28257099-28257121 CCTGGGGCAGTTGCCCCTCTTCC No data
Right 1038523913 8:28257119-28257141 TCCTCTCTCGGGTTTAGAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1038523913 Original CRISPR TCCTCTCTCGGGTTTAGAGT GGG Intergenic
No off target data available for this crispr