ID: 1038525782

View in Genome Browser
Species Human (GRCh38)
Location 8:28271981-28272003
Sequence GTCTCAGTGGTCTTTTGGGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1038525782_1038525789 22 Left 1038525782 8:28271981-28272003 CCTACCCAAAAGACCACTGAGAC No data
Right 1038525789 8:28272026-28272048 AAGTTGTGCTTTGGGTATGTTGG No data
1038525782_1038525787 13 Left 1038525782 8:28271981-28272003 CCTACCCAAAAGACCACTGAGAC No data
Right 1038525787 8:28272017-28272039 GTAAAGTAAAAGTTGTGCTTTGG No data
1038525782_1038525790 23 Left 1038525782 8:28271981-28272003 CCTACCCAAAAGACCACTGAGAC No data
Right 1038525790 8:28272027-28272049 AGTTGTGCTTTGGGTATGTTGGG No data
1038525782_1038525788 14 Left 1038525782 8:28271981-28272003 CCTACCCAAAAGACCACTGAGAC No data
Right 1038525788 8:28272018-28272040 TAAAGTAAAAGTTGTGCTTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1038525782 Original CRISPR GTCTCAGTGGTCTTTTGGGT AGG (reversed) Intergenic
No off target data available for this crispr