ID: 1038530653

View in Genome Browser
Species Human (GRCh38)
Location 8:28315957-28315979
Sequence CTGGATTTAGACTGAGGTGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1038530653_1038530662 26 Left 1038530653 8:28315957-28315979 CCATCACCTCAGTCTAAATCCAG No data
Right 1038530662 8:28316006-28316028 CCCTATACCATTTGCAGTCAGGG No data
1038530653_1038530660 25 Left 1038530653 8:28315957-28315979 CCATCACCTCAGTCTAAATCCAG No data
Right 1038530660 8:28316005-28316027 ACCCTATACCATTTGCAGTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1038530653 Original CRISPR CTGGATTTAGACTGAGGTGA TGG (reversed) Intergenic
No off target data available for this crispr