ID: 1038535139

View in Genome Browser
Species Human (GRCh38)
Location 8:28348350-28348372
Sequence CGTTCTGCTTCCTGCTGAGT CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 280
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 261}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1038535139_1038535142 25 Left 1038535139 8:28348350-28348372 CCGACTCAGCAGGAAGCAGAACG 0: 1
1: 0
2: 1
3: 17
4: 261
Right 1038535142 8:28348398-28348420 AAGCTAATCCCCTAGAGAGTGGG 0: 1
1: 0
2: 0
3: 3
4: 153
1038535139_1038535143 26 Left 1038535139 8:28348350-28348372 CCGACTCAGCAGGAAGCAGAACG 0: 1
1: 0
2: 1
3: 17
4: 261
Right 1038535143 8:28348399-28348421 AGCTAATCCCCTAGAGAGTGGGG 0: 1
1: 0
2: 0
3: 10
4: 160
1038535139_1038535141 24 Left 1038535139 8:28348350-28348372 CCGACTCAGCAGGAAGCAGAACG 0: 1
1: 0
2: 1
3: 17
4: 261
Right 1038535141 8:28348397-28348419 CAAGCTAATCCCCTAGAGAGTGG 0: 1
1: 0
2: 2
3: 4
4: 65

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1038535139 Original CRISPR CGTTCTGCTTCCTGCTGAGT CGG (reversed) Exonic
901019073 1:6246833-6246855 CGGTCTGCTTCCCGCGGTGTGGG + Intergenic
902112559 1:14094868-14094890 AGCTCTGTTTCCTGCTGTGTTGG + Intergenic
905954816 1:41983660-41983682 CATCCTGCTTGCTGGTGAGTCGG - Intronic
906506786 1:46386162-46386184 CTAACTGCTTCCTGCTGAATTGG + Intergenic
907505023 1:54911824-54911846 CTAACTGCTTCCTGCTGAATTGG + Intergenic
907602342 1:55784004-55784026 CTAACTGCTTCCTGCTGAATTGG + Intergenic
907949269 1:59165395-59165417 CTTTCTGCCTCCTGATGAATAGG + Intergenic
908735587 1:67272923-67272945 CTTCCTCCTTCCTGCTGACTGGG + Intergenic
909440413 1:75690024-75690046 ATTTCTACTTCCTGCTGATTAGG - Intergenic
910617441 1:89215234-89215256 CTGGCTGCTTCCTGCTGAGGAGG - Intergenic
910804939 1:91180736-91180758 CTAACTGCTTCCTGCTGAATTGG - Intergenic
912463470 1:109853032-109853054 TGCTCTGCTTCCTGCTGAATTGG + Intergenic
915050945 1:153071652-153071674 AGTTCCACTTCCTGCTGGGTGGG - Intergenic
915052858 1:153094567-153094589 AGTTCCACTTCCTGCTGGGTGGG - Intronic
917988977 1:180352548-180352570 TATTCTGCTTCCTACTGAGAGGG + Intronic
918011048 1:180586834-180586856 CTTTCTACTTCCTGCTGAAATGG - Intergenic
918142785 1:181732766-181732788 CCCCCTGCCTCCTGCTGAGTCGG - Exonic
918522378 1:185429009-185429031 CTTTCTCCTTCCTGAAGAGTTGG - Intergenic
919755853 1:201066031-201066053 CTTGCTGCCTCCTGATGAGTTGG + Intronic
919919830 1:202161264-202161286 CTATCTGCTTCCTGCTGGGCTGG - Exonic
921092377 1:211856131-211856153 CTAACTGCTTCCTGCTGAATTGG + Intergenic
921835295 1:219772241-219772263 GGGTCTGTTTCCTGCTGGGTTGG - Intronic
922684004 1:227625334-227625356 CTAACTGCTTCCTGCTGAATTGG + Intronic
1064376708 10:14802910-14802932 CCTGCTGCTTCTTGCTGACTGGG - Intergenic
1066448422 10:35505566-35505588 CGTTCTGCCACCTGCTAATTGGG + Intronic
1067353816 10:45504867-45504889 CGTCCCTCTTCCTCCTGAGTAGG + Intronic
1071326788 10:84526188-84526210 CTAACTGCTTCCTGCTGAATTGG + Intergenic
1071479845 10:86056928-86056950 CCTTGTGCTTCCTGCAGAGCTGG + Intronic
1072377666 10:94834951-94834973 CTAGCTGCTTCCTGCTGAATTGG + Intronic
1072650418 10:97290859-97290881 CTAACTGCTTCCTGCTGAATTGG - Intronic
1075624403 10:123951169-123951191 CTCCCTGCTTCCTGCTGAGGGGG - Intergenic
1076654524 10:132014786-132014808 TGTACTGCTTCATGCTGACTTGG - Intergenic
1076945381 10:133645290-133645312 GGAGCTGTTTCCTGCTGAGTGGG + Intergenic
1077123036 11:919406-919428 CATGCTGCTTCCTGCTCATTGGG + Intergenic
1078932001 11:15920094-15920116 TTTTCTTCTTCCTGATGAGTAGG + Intergenic
1081429135 11:42956737-42956759 AGCTCTGCTTCCTCCTGTGTTGG + Intergenic
1083459503 11:62801412-62801434 CCTTCTGCTTCCTGAAGATTTGG - Exonic
1083459933 11:62804539-62804561 CCTTCTGATTCATGCTGTGTAGG + Intronic
1083888537 11:65584504-65584526 TGTTCTGCTTGATGTTGAGTGGG - Exonic
1089336788 11:117730523-117730545 CCTTCTGATTGCTGCTGTGTTGG - Intronic
1091169267 11:133506022-133506044 CATTGTGCTTCCAGCTGGGTTGG - Intronic
1093942606 12:25071013-25071035 TGTTATTCTTCCTGTTGAGTGGG + Intronic
1095284130 12:40388724-40388746 CTAACTGCTTCCTGCTGAATTGG - Intergenic
1095470878 12:42535599-42535621 AGTTCTGCTTCCTACTCTGTTGG - Intronic
1095521407 12:43071100-43071122 CTTTCTGCTTCCTCCTCACTGGG + Intergenic
1095962012 12:47841364-47841386 TGTCCTGCTTCCTATTGAGTTGG - Intergenic
1096882924 12:54687228-54687250 CCTTCTGCTCCCTTCAGAGTGGG - Intergenic
1097905573 12:64915680-64915702 ACTTCTGCTTCCTGCTGTCTTGG + Intergenic
1098648078 12:72930593-72930615 CCTTGTGCTTGTTGCTGAGTGGG + Intergenic
1101432437 12:104637798-104637820 TGGTCTGCTTCCTGCTCAGCAGG + Intronic
1101465367 12:104943638-104943660 CTAACTGCTTCCTGCTGAATTGG - Intronic
1102422102 12:112811950-112811972 CGTTCTGCTTTCTTCTGGGTTGG + Intronic
1103760188 12:123243881-123243903 CATCCTGCTTCCTCCTCAGTGGG + Intronic
1104044333 12:125151316-125151338 CGTCCTTCTTCCTTCTGCGTAGG + Intergenic
1105429651 13:20325485-20325507 CTTGCTGCTTCCTGCTGACAAGG - Intergenic
1106083490 13:26519955-26519977 TGGTCTGGTTCCTGCCGAGTTGG + Intergenic
1107451939 13:40517587-40517609 TGTTCAGCTGCCTGCTGAGTGGG + Intergenic
1108877146 13:55060867-55060889 TGCTCTGTTTCCTGCTGAATTGG - Intergenic
1109192965 13:59347023-59347045 GGTACTGCTGCCTGCAGAGTGGG + Intergenic
1111070426 13:83158884-83158906 ACTTCTGCTTCCTCCTGATTGGG - Intergenic
1111956635 13:94766194-94766216 AGTACTGCTCCCTGCAGAGTAGG - Intergenic
1112667436 13:101592069-101592091 GATTCTGCTTCCTACAGAGTGGG - Intronic
1113300394 13:109012915-109012937 ACTTCTCCTTCCTGTTGAGTAGG + Intronic
1113539718 13:111096993-111097015 CCTGCTGCTTTCTCCTGAGTAGG + Intergenic
1114840770 14:26260117-26260139 CTAACTGCTTCCTGCTGAATTGG - Intergenic
1115881841 14:37928079-37928101 CTTGCTGCTTTCTGCTGCGTTGG - Intronic
1116446675 14:45019870-45019892 CTAACTGCTTCCTGCTGAATTGG + Intronic
1117672875 14:58125738-58125760 CTAACTGCTTCCTGCTGAATTGG - Intronic
1118672098 14:68139976-68139998 GCTTCTGCTTCCTGCTAATTTGG + Intronic
1118839643 14:69500876-69500898 CATCTTGCTTGCTGCTGAGTCGG + Exonic
1121097224 14:91226040-91226062 CTAACTGCTTCCTGCTGAATTGG + Intergenic
1202919405 14_KI270723v1_random:17094-17116 GGAGCTGTTTCCTGCTGAGTGGG + Intergenic
1124964716 15:34424279-34424301 CTTTCTGCTTCATGGTCAGTGGG - Intronic
1124981332 15:34570505-34570527 CTTTCTGCTTCATGGTCAGTGGG - Intronic
1128362122 15:66969607-66969629 CTAACTGCTTCCTGCTGAATTGG + Intergenic
1129798424 15:78395521-78395543 AGAGCTGCTTCCTGGTGAGTCGG - Intergenic
1131263729 15:90903411-90903433 CGTCCTCCTTCCTCCTGAGCAGG + Exonic
1132806622 16:1777977-1777999 CGTTCTGCAGCCTGCTGGGCAGG - Exonic
1133551322 16:6857171-6857193 CTTTCAGGTTCCTGCTGATTTGG + Intronic
1137390116 16:48074345-48074367 TGTTCTGCTTTCTTCTGTGTTGG + Intergenic
1139056741 16:63194917-63194939 CCTTCTGCTTCCTGCTGGTGGGG - Intergenic
1139200260 16:64968535-64968557 TTTCCTGCTGCCTGCTGAGTCGG + Intronic
1140532928 16:75682705-75682727 GTGACTGCTTCCTGCTGAGTAGG + Intronic
1144202217 17:12951976-12951998 CTGTCTGTGTCCTGCTGAGTTGG - Intronic
1146769095 17:35552188-35552210 CTAACTGCTTCCTGCTGAATTGG - Intronic
1146997845 17:37336275-37336297 CTAACTGCTTCCTGCTGAATTGG - Intronic
1147538413 17:41335550-41335572 GCTTCTGCTTCCTGGAGAGTGGG + Intergenic
1148636462 17:49152783-49152805 TGTTCTCCTTCCTGCAGAGAAGG + Exonic
1148774359 17:50087383-50087405 CTTTCTGCTTTCTGATGAGGGGG - Intronic
1150974613 17:70070695-70070717 TGTTCTCCTTCCTGCTAAGGTGG + Intronic
1154360623 18:13657431-13657453 CTAACTGCTTCCTGCTGAATTGG - Intergenic
1155185227 18:23381841-23381863 GGTTTTGCTTCCTGATGAGCAGG - Intronic
1155495479 18:26437878-26437900 CTTCCTGCTTCCTTGTGAGTGGG - Intergenic
1155971181 18:32085290-32085312 GGTCCTGCTTCCTGCTGGGCAGG - Intergenic
1156391448 18:36654176-36654198 GGTGCAGCTTCCTGTTGAGTAGG - Intronic
1156458095 18:37305991-37306013 CACTCTGCTTACAGCTGAGTTGG + Intronic
1157200273 18:45653720-45653742 CCTTCTGATTCCTGCTGACTGGG - Intronic
1157267524 18:46240375-46240397 ATTTCTACTTCCTTCTGAGTAGG - Intronic
1157490847 18:48122764-48122786 AGTTCTTCTTCCTCCTGGGTTGG - Intronic
1157950724 18:52034083-52034105 CTTTCTGCTTGCTTCTGATTGGG + Intergenic
1158961501 18:62591392-62591414 CTGTCTGCTTCCTGCAGGGTGGG + Intergenic
1159082629 18:63752797-63752819 CTCTGTGCTTCCTGCAGAGTCGG + Intergenic
1161155479 19:2730331-2730353 CTTTGTGCTTCCTGCTGTGATGG + Intronic
1164057547 19:21634376-21634398 CTAACTGCTTCCTGCTGAATTGG - Intergenic
1166655627 19:44609496-44609518 CGTTCAGATTCCTGCAGAGGTGG + Intergenic
1166856578 19:45785387-45785409 CTTTCTGCTGCCTGCTGCCTAGG + Intronic
924972682 2:143432-143454 CTGGCTGCTTCCTGCTGAGAGGG + Intergenic
926816435 2:16802355-16802377 CTAACTGCTTCCTGCTGAATTGG + Intergenic
926864921 2:17345856-17345878 CTAACTGCTTCCTGCTGAATTGG - Intergenic
927066821 2:19480172-19480194 CATTCCGCCTCCTGTTGAGTAGG + Intergenic
927787105 2:25981842-25981864 CCTCCTCCTTCCTGCTGAGGGGG + Exonic
928476681 2:31633666-31633688 CTAACTGCTTCCTGCTGAATTGG - Intergenic
933966996 2:87438101-87438123 AGTTCTGGTTCCTGCTCAGTAGG + Intergenic
935749172 2:106215258-106215280 CGCTCTGTTTCCTGCTGAATTGG - Intergenic
936261799 2:110966262-110966284 GGTTCTTGTTGCTGCTGAGTGGG - Intronic
936326801 2:111512396-111512418 AGTTCTGGTTCCTGCTCAGTAGG - Intergenic
937863563 2:126731722-126731744 TGTTCTGCTGCATGCTGAGGTGG - Intergenic
939493218 2:142900742-142900764 CTAACTGCTTCCTGCTGAATTGG + Intronic
941991334 2:171560419-171560441 CTAACTGCTTCCTGCTGAATTGG + Intergenic
942374830 2:175326123-175326145 CTAACTGCTTCCTGCTGAATTGG - Intergenic
942704809 2:178758694-178758716 CCTTCTGATTCATGCTGATTAGG + Intronic
944039119 2:195335063-195335085 CTAACTGCTTCCTGCTGAATTGG + Intergenic
944719205 2:202406076-202406098 CCTTCTGCTTACTGATGAGTAGG + Intronic
946129028 2:217591230-217591252 CTAACTGCTTCCTGCTGAATTGG + Intronic
948719726 2:239891466-239891488 AGTTATGCTTCCTGCGGAGATGG - Intergenic
948852334 2:240714539-240714561 GCTGCTGCTTCCTGCTAAGTGGG - Exonic
949066500 2:241993867-241993889 CATTCTGATTCTTGCTGAGGTGG + Intergenic
1169150307 20:3284134-3284156 CGTGGTGCTTCCTTCTGGGTAGG - Intronic
1170397941 20:15947996-15948018 CTAACTGCTTCCTGCTGAATTGG - Intronic
1170647143 20:18207617-18207639 AGTCCTGCTTCATTCTGAGTAGG - Intergenic
1172815492 20:37682796-37682818 AGTTCTCCTGCCTGCGGAGTTGG + Intergenic
1173198139 20:40932813-40932835 TGTGCTGCTCCCTGGTGAGTGGG + Intergenic
1173900034 20:46581049-46581071 GGTTCTGCTTCTTGTGGAGTGGG - Intronic
1174318844 20:49724832-49724854 AGTTCTGCTTCCCTCTGAGTTGG + Intergenic
1174977669 20:55352645-55352667 CTAACTGCTTCCTGCTGAATTGG - Intergenic
1175292912 20:57890250-57890272 GGTTCTGCTCGCTGCTGAGCAGG + Intergenic
1176336932 21:5607787-5607809 GGAGCTGTTTCCTGCTGAGTGGG - Intergenic
1176390825 21:6213161-6213183 GGAGCTGTTTCCTGCTGAGTGGG + Intergenic
1176470594 21:7103013-7103035 GGAGCTGTTTCCTGCTGAGTGGG - Intergenic
1176494155 21:7484791-7484813 GGAGCTGTTTCCTGCTGAGTGGG - Intergenic
1176506487 21:7653592-7653614 GGAGCTGTTTCCTGCTGAGTGGG + Intergenic
1177263074 21:18753580-18753602 CTAACTGCTTCCTGCTGAATTGG + Intergenic
1179584564 21:42366382-42366404 CGTGCTTCTTCCTGCTCTGTGGG - Intronic
1179603951 21:42499881-42499903 CCTTCTGCTTCCTGGTGGGATGG + Intronic
1181744662 22:24947630-24947652 AGTTCTGTTTTCTGCTCAGTTGG + Intergenic
1183350581 22:37332598-37332620 CGTCCTGCTTCCTGCTGTGGGGG - Intergenic
1185128578 22:49025086-49025108 GCTCCTCCTTCCTGCTGAGTAGG - Intergenic
951263788 3:20543425-20543447 CTTTCTGCTTACTGCTGTATTGG + Intergenic
951371936 3:21859929-21859951 CGCTCTGCATCCTGCTGAAATGG + Intronic
953085293 3:39659671-39659693 CTAACTGCTTCCTGCTGAATTGG - Intergenic
953804279 3:46054459-46054481 CGTTCGGCTCCCTGCAAAGTGGG + Intergenic
954049540 3:47962226-47962248 AGTGCTGCTTCTTGCTGAGCAGG - Intronic
954608378 3:51931020-51931042 CGCTCTTCTTACTCCTGAGTCGG - Intergenic
954649307 3:52150481-52150503 CTTTCTGGTTCCTGCAGAGGAGG - Intronic
955537091 3:59935146-59935168 GGTTCTGCTTGCTGCTGGGTGGG + Intronic
956814672 3:72897310-72897332 AGCTCTGCTTCCTTCTGTGTGGG + Intronic
956999837 3:74873216-74873238 CTAACTGCTTCCTGCTGAATTGG + Intergenic
957082105 3:75645178-75645200 GGAGCTGTTTCCTGCTGAGTGGG - Intergenic
957313231 3:78545617-78545639 TGAATTGCTTCCTGCTGAGTGGG - Intergenic
958629296 3:96667209-96667231 CTAACTGCTTCCTGCTGAATTGG + Intergenic
959761788 3:109975003-109975025 CTAACTGCTTCCTGCTGAATTGG + Intergenic
960357731 3:116674103-116674125 CCTGCTGCTTCCTGGTGATTAGG - Intronic
960928051 3:122815834-122815856 CTTTCTGCTTGATGCTGATTTGG + Intronic
961353711 3:126320771-126320793 AACTCTGCTTCCAGCTGAGTTGG - Intergenic
961991519 3:131197255-131197277 CTAACTGCTTCCTGCTGAATTGG + Intronic
963188469 3:142443248-142443270 CTAACTGCTTCCTGCTGAATTGG - Intronic
963809028 3:149756845-149756867 CTAACTGCTTCCTGCTGAATTGG + Intergenic
963916211 3:150860931-150860953 CTAACTGCTTCCTGCTGAATTGG - Intergenic
967624006 3:191665186-191665208 CTAACTGCTTCCTGCTGAATTGG - Intergenic
967888250 3:194347467-194347489 CTTTGTGCTTCCAGCTGAGCTGG - Intronic
968618785 4:1594210-1594232 CGTCCTGCCTCCTGCTATGTGGG - Intergenic
968768808 4:2490003-2490025 CCTTCTGGTTCCTGAGGAGTTGG + Intronic
969303312 4:6309992-6310014 CCTTCTTCTGCCTGCTTAGTTGG - Intergenic
971175691 4:24280341-24280363 CTTTCTGCTTCCTGGGAAGTTGG - Intergenic
976190106 4:82479257-82479279 CTAACTGCTTCCTGCTGAATTGG - Intergenic
976464507 4:85352512-85352534 CTAACTGCTTCCTGCTGAATTGG + Intergenic
978155893 4:105489062-105489084 CTAACTGCTTCCTGCTGAATTGG - Intergenic
979191298 4:117862490-117862512 CTTTCTGTTCCCTGCTGAGTAGG - Intergenic
980872032 4:138622595-138622617 CTAACTGCTTCCTGCTGAATTGG + Intergenic
982189720 4:152841926-152841948 CTAACTGCTTCCTGCTGAATTGG - Intronic
984059337 4:174973061-174973083 CTTTCAGCTTCCTGCTGTGGAGG - Intronic
985207066 4:187550159-187550181 CTGGCTGCTTCCTGCTGAGGAGG + Intergenic
985448764 4:190045802-190045824 GGAGCTGTTTCCTGCTGAGTGGG + Intergenic
986460673 5:7967941-7967963 TGTTCTGCTCCCTGGAGAGTGGG + Intergenic
986495534 5:8338300-8338322 CTTTCTGCATCCTGCAGACTTGG + Intergenic
987511111 5:18840420-18840442 TGATCTGCTTTCTGCTGAGTGGG + Intergenic
987902002 5:24024020-24024042 TTTTCTGCTTCCTTCTGATTTGG - Intronic
988122825 5:26990217-26990239 CATTCTTCTTTCTGCTGAGTTGG - Intronic
989104847 5:37852405-37852427 TCTTCTGCTTCCTTCTGAGATGG - Intergenic
989329975 5:40245686-40245708 AGTTCTGCTTTCTGCTGTGACGG - Intergenic
990186797 5:53218735-53218757 GAAACTGCTTCCTGCTGAGTAGG + Intergenic
990617230 5:57520404-57520426 CTAACTGCTTCCTGCTGAATTGG + Intergenic
993590891 5:89794190-89794212 CTAACTGCTTCCTGCTGAATTGG - Intergenic
995125653 5:108574942-108574964 CTAACTGCTTCCTGCTGAATTGG + Intergenic
995466094 5:112450646-112450668 CTAACTGCTTCCTGCTGAATTGG - Intergenic
997541226 5:134664595-134664617 CATTCTTGTTCATGCTGAGTTGG + Intronic
998072869 5:139212082-139212104 GGCTCTGCTTTCAGCTGAGTTGG + Intronic
998678579 5:144438446-144438468 CGCTCTGTTTTCTGCTGTGTGGG + Intronic
998959529 5:147470093-147470115 CCTTCAGCTTGCTCCTGAGTTGG - Intronic
999248739 5:150169076-150169098 CTTTCTGCTTCCTGCTCATGGGG + Intronic
999361019 5:150986942-150986964 CTAGCTGCTTCCTGCTGAATAGG + Intergenic
1000625557 5:163534128-163534150 CTCACTGCTTCCTGCTGAATTGG + Intergenic
1001306058 5:170573900-170573922 GTTTGTGCTTCCAGCTGAGTTGG + Intronic
1002890842 6:1330431-1330453 CTAACTGCTTCCTGCTGAATTGG + Intergenic
1004294963 6:14401948-14401970 CATTCTGCTGCCTTCTGACTAGG + Intergenic
1005516083 6:26555790-26555812 GGTTCTGCTTTCTTCTGAGAAGG + Intergenic
1005662394 6:28012123-28012145 CCTTCTGCTTCCTTCAGACTTGG - Intergenic
1007196110 6:40062145-40062167 CTGTCAGCTTCCTGCTGAATGGG - Intergenic
1008581881 6:52915064-52915086 CTAACTGCTTCCTGCTGAATTGG + Intergenic
1009035313 6:58110773-58110795 GATTCTGCTTCCTTCTGTGTTGG + Intergenic
1009211131 6:60864364-60864386 GATTCTGCTTCCTTCTGTGTTGG + Intergenic
1010372454 6:75126702-75126724 GATACTGCTTCCTGCTGAGAAGG - Intronic
1011209973 6:84944904-84944926 CTAGCTGCTTCCTGCTGAATTGG - Intergenic
1011310186 6:85972791-85972813 CTAACTGCTTCCTGCTGAATAGG + Intergenic
1011539401 6:88414576-88414598 CTAACTGCTTCCTGCTGAATTGG + Intergenic
1012713422 6:102637639-102637661 GTTACTGCTTCCTGCTGACTTGG - Intergenic
1013796807 6:113897338-113897360 CTAACTGCTTCCTGCTGAATTGG + Intergenic
1015865041 6:137719312-137719334 CTAACTGCTTCCTGCTGAATTGG + Intergenic
1017422076 6:154282915-154282937 GGCTCTGCTTCCTGCTGTTTTGG - Intronic
1018761503 6:166897849-166897871 CTAACTGCTTCCTGCTGAATTGG - Intronic
1020216978 7:6200611-6200633 TGTTCTGTTTCCTGCAGAATCGG - Intronic
1020265547 7:6557657-6557679 CGTTCTGCTTACTCCTGGTTGGG + Intergenic
1021274972 7:18639244-18639266 TGTTATGCTCCCTTCTGAGTGGG + Intronic
1022989852 7:35696187-35696209 CTAACTGCTTCCTGCTGAATTGG - Intergenic
1023439072 7:40168279-40168301 CTAACTGCTTCCTGCTGAATTGG + Intronic
1024439616 7:49401323-49401345 AGTTCTCCTTCCTGCAGTGTGGG + Intergenic
1025009771 7:55386758-55386780 CCAGCTGCTTCCTGCTGACTAGG + Intronic
1026268639 7:68817375-68817397 TGTTCTCCTTCCTGCTGCCTAGG - Intergenic
1028587794 7:92468765-92468787 CTAACTGCTTCCTGCTGAATTGG + Exonic
1030337759 7:108344086-108344108 CCAACTGCTTCCTGCTGAATTGG - Intronic
1030843040 7:114379473-114379495 CTAACTGCTTCCTGCTGAATTGG + Intronic
1031265010 7:119570432-119570454 CTTACTGCTTCCTGCTGAATTGG - Intergenic
1032726227 7:134592172-134592194 CTAACTGCTTCCTGCTGAATTGG - Intergenic
1036510318 8:9393943-9393965 CATACTGCTTCCTGATGAGTTGG + Intergenic
1038330016 8:26600895-26600917 CTTTCTGCTTCCTGATGGGGTGG + Intronic
1038535139 8:28348350-28348372 CGTTCTGCTTCCTGCTGAGTCGG - Exonic
1039628049 8:39076409-39076431 CGTTCTTCTTTCTGCTTATTAGG - Intronic
1040443267 8:47466780-47466802 TGTTCTGCTAGCTTCTGAGTTGG - Intronic
1040515777 8:48133557-48133579 AGTTCTTTTTTCTGCTGAGTAGG + Intergenic
1040789496 8:51209360-51209382 CATTCTGCTTCATCCTGACTAGG + Intergenic
1041663293 8:60419803-60419825 CTAACTGCTTCCTGCTGAATTGG + Intergenic
1042205654 8:66327414-66327436 CTGGCTGCTTCCTGCTGAATAGG - Intergenic
1043390046 8:79783744-79783766 CTTTCCGCGTCCTGCTGAGAGGG - Intergenic
1043490427 8:80742783-80742805 CTAACTGCTTCCTGCTGAATTGG - Intronic
1043533156 8:81172123-81172145 AGCTCTGCCTCCTTCTGAGTTGG - Intergenic
1046373063 8:113336733-113336755 TCTTCTGCTTCCTGCTGGGGTGG - Intronic
1047443628 8:124900605-124900627 CTAACTGCTTCCTGCTGAATTGG + Intergenic
1048474885 8:134734110-134734132 TGTTCTGCCTCATGCTTAGTCGG + Intergenic
1049255751 8:141612774-141612796 TGTTCTGCTCCCTGCTGAGTAGG - Intergenic
1050734536 9:8748116-8748138 CTAACTGCTTCCTGCTGAATTGG - Intronic
1050954908 9:11643667-11643689 CTTTCTGCTTCATTTTGAGTAGG + Intergenic
1051415534 9:16835998-16836020 TGTACTGCAGCCTGCTGAGTGGG - Intronic
1051965474 9:22823435-22823457 CTAACTGCTTCCTGCTGAATTGG - Intergenic
1052384185 9:27805674-27805696 CTGGCTGCTTCCTGCTTAGTAGG + Intergenic
1056704476 9:88940394-88940416 CTAACTGCTTCCTGCTGAATTGG + Intergenic
1057058399 9:91981674-91981696 CTAACTGCTTCCTGCTGAATTGG - Intergenic
1058022755 9:100106779-100106801 CTTCCTCCTTCCTGCTGACTGGG - Intronic
1059356570 9:113704151-113704173 CTTTCGGCTTCCTGCTGCCTTGG + Intergenic
1059876492 9:118641164-118641186 CTGGCTGCTTCCTGCTGAATAGG - Intergenic
1061639657 9:131942451-131942473 ATGTTTGCTTCCTGCTGAGTCGG - Intronic
1203424720 Un_GL000195v1:27115-27137 GGAGCTGTTTCCTGCTGAGTGGG + Intergenic
1203443395 Un_GL000219v1:32245-32267 GGAGCTGTTTCCTGCTGAGTGGG + Intergenic
1203514203 Un_KI270741v1:151154-151176 GGAGCTGTTTCCTGCTGAGTGGG + Intergenic
1186660984 X:11666601-11666623 CTGTCTGCTCCCTGCTGAGATGG - Intergenic
1193307145 X:79962689-79962711 CTAACTGCTTCCTGCTGAATTGG - Intergenic
1193591498 X:83393413-83393435 AGAGCTGCTTCCTGCTGAGTGGG - Intergenic
1194079015 X:89434571-89434593 TTTTCTGCTTGCTTCTGAGTTGG + Intergenic
1194355185 X:92874453-92874475 CTTTCTGGCTCCTGCTAAGTTGG + Intergenic
1194492583 X:94569623-94569645 CTAACTGCTTCCTGCTGAATTGG + Intergenic
1195319146 X:103707169-103707191 CCTCCTGCTTCCTCCTGGGTGGG - Intergenic
1196526894 X:116738339-116738361 CTAACTGCTTCCTGCTGAATTGG + Intergenic
1196795886 X:119501697-119501719 AGGTCTGCTTCCTGCTGCCTTGG + Intergenic
1198242414 X:134798607-134798629 CCAACTGCTTCCTGCTGATTAGG + Intronic
1198331234 X:135624950-135624972 GAAGCTGCTTCCTGCTGAGTGGG + Intergenic
1198335105 X:135658178-135658200 GAAGCTGCTTCCTGCTGAGTGGG - Intergenic
1198363774 X:135921143-135921165 GAAGCTGCTTCCTGCTGAGTGGG + Intergenic
1198743177 X:139862716-139862738 GGCTCTGCTTCCTGCTTAGGTGG - Intronic
1198766074 X:140080417-140080439 CTAACTGCTTCCTGCTGAATTGG - Intergenic
1200431637 Y:3089889-3089911 TTTTCTGCTTGCTTCTGAGTTGG + Intergenic
1200663542 Y:5991475-5991497 CTTTCTGGCTCCTGCTAAGTTGG + Intergenic