ID: 1038535141

View in Genome Browser
Species Human (GRCh38)
Location 8:28348397-28348419
Sequence CAAGCTAATCCCCTAGAGAG TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 72
Summary {0: 1, 1: 0, 2: 2, 3: 4, 4: 65}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1038535140_1038535141 -6 Left 1038535140 8:28348380-28348402 CCTTCTTTTGACACGCACAAGCT 0: 1
1: 0
2: 0
3: 8
4: 75
Right 1038535141 8:28348397-28348419 CAAGCTAATCCCCTAGAGAGTGG 0: 1
1: 0
2: 2
3: 4
4: 65
1038535139_1038535141 24 Left 1038535139 8:28348350-28348372 CCGACTCAGCAGGAAGCAGAACG 0: 1
1: 0
2: 1
3: 17
4: 261
Right 1038535141 8:28348397-28348419 CAAGCTAATCCCCTAGAGAGTGG 0: 1
1: 0
2: 2
3: 4
4: 65

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1038535141 Original CRISPR CAAGCTAATCCCCTAGAGAG TGG Exonic
903274674 1:22212921-22212943 CACGCTAATCCTCTGGGGAGGGG + Intergenic
906832050 1:49043371-49043393 TAAGATAATCCCATAGAGAGTGG - Intronic
907819370 1:57952238-57952260 CATGCCAATCCTCAAGAGAGGGG - Intronic
911238842 1:95442271-95442293 CTTGCTAAGTCCCTAGAGAGAGG + Intergenic
913482733 1:119304375-119304397 CACGATAATCCCCTTGAGATAGG + Intergenic
917932657 1:179834010-179834032 TAAGATAATCCAGTAGAGAGGGG + Intergenic
918787849 1:188787972-188787994 CAAGCTAATCCCAAAGCCAGTGG - Intergenic
918843922 1:189583956-189583978 CAAAGTAATGCCCTTGAGAGTGG + Intergenic
919987487 1:202685995-202686017 CAAGCACATCCACCAGAGAGAGG + Intronic
1063196917 10:3752285-3752307 CAGAATGATCCCCTAGAGAGTGG + Intergenic
1063666322 10:8062756-8062778 CAAGTTGGTCCCCCAGAGAGGGG - Intronic
1064607523 10:17059369-17059391 TAAGCTGATCCTCTGGAGAGAGG + Intronic
1079902275 11:26202066-26202088 CAAACTGATCCCCTGGAGATTGG + Intergenic
1083304480 11:61755344-61755366 CCGGCTAATCCCCTAGAGAGAGG + Intronic
1085701234 11:78747644-78747666 CAAGCAAATCCCACAGTGAGGGG - Intronic
1087895363 11:103580161-103580183 GAAGCTAATCCAGAAGAGAGGGG - Intergenic
1090545541 11:127762751-127762773 GAAGCTACTCCCCAAGAGAAAGG - Intergenic
1090998815 11:131891141-131891163 CAAGCTAATCCCTTGTAGGGAGG + Intronic
1092668620 12:10836422-10836444 ATAACTAATCCCCAAGAGAGAGG + Intronic
1100745707 12:97643428-97643450 CATCCTAATCACCTAGTGAGGGG + Intergenic
1101872384 12:108576916-108576938 CAAGCTCATCCCACAGCGAGTGG + Intergenic
1107101925 13:36602452-36602474 CAAGCCAATGCCATAGAGATTGG - Intergenic
1114244508 14:20900171-20900193 CTAGCTAACCCCCTGGAAAGGGG - Intergenic
1115418694 14:33167300-33167322 CATTCAAATCTCCTAGAGAGAGG + Intronic
1116788852 14:49318240-49318262 CAAGCTCATTGCCCAGAGAGGGG + Intergenic
1117287282 14:54298696-54298718 CAAGGGAATGCCCTGGAGAGAGG + Intergenic
1118074344 14:62281910-62281932 CAACCTAATACCAGAGAGAGAGG - Intergenic
1121721866 14:96115004-96115026 CAAGCTCATCCACTAGAAATGGG - Intergenic
1125504276 15:40257958-40257980 CAGGCTGAGCCCCTACAGAGGGG + Intronic
1153521954 18:5962163-5962185 CATGCTAACACCCTTGAGAGAGG + Intronic
928609872 2:32982506-32982528 CAAGTTAATCACCAAGACAGTGG + Intronic
929871397 2:45762066-45762088 GCAGCTACTCCCCTAGAGAGTGG - Intronic
946155254 2:217802875-217802897 TATGCGAGTCCCCTAGAGAGAGG - Exonic
1173466352 20:43285059-43285081 CAAGCTAATCCCCAAGTTTGGGG - Intergenic
1174615655 20:51833387-51833409 CAAGGTAATCCTTAAGAGAGAGG + Intergenic
1174705564 20:52652453-52652475 CAAGGGAATTCCCTAGAAAGGGG + Intergenic
1181676790 22:24459804-24459826 CAAGGGAATCCCCTGGACAGTGG + Intergenic
956217072 3:66859654-66859676 CAAGGTTATCCACTAGAAAGTGG + Intergenic
956845360 3:73177418-73177440 CCAGCTAATTACCCAGAGAGTGG - Intergenic
958823872 3:99007177-99007199 CAGTCACATCCCCTAGAGAGGGG - Intergenic
961567973 3:127777015-127777037 AAAGCTATGCCCTTAGAGAGGGG + Intronic
962410682 3:135139334-135139356 CAAACCAATCCCTTTGAGAGTGG - Intronic
966300715 3:178476678-178476700 CAAGCTACTCCCCTTGAAATAGG + Intronic
970288859 4:14549958-14549980 CACGTTAATCCCCTTCAGAGAGG + Intergenic
978421328 4:108536202-108536224 CAAACTAATTCCCCAGAGAATGG - Intergenic
980794050 4:137658282-137658304 CAAGATAATGCCCTCCAGAGGGG - Intergenic
983389395 4:167110019-167110041 CAAGCAAATACCCTAGAGAGAGG - Intronic
999440757 5:151598923-151598945 CAAGCTATTTCCCAAGAGTGAGG + Intergenic
1001829521 5:174773914-174773936 CAAGCCCATTCCCAAGAGAGAGG - Intergenic
1005427366 6:25716856-25716878 CAAGCAAATCCCCCCCAGAGGGG + Intergenic
1014843501 6:126247102-126247124 CAAGCTAAGCCCATACAGCGAGG - Intergenic
1018642738 6:165919380-165919402 CAAGGTTATCCCCTAGATGGAGG - Intronic
1022408601 7:30118090-30118112 CAGGCTGATCCCCTGGAGAGAGG - Intronic
1022409762 7:30130147-30130169 CTAGCTCATCCTCTAGAGAGAGG - Intronic
1023637905 7:42230834-42230856 CCAGCTAACCCCGTAGAAAGTGG - Intronic
1023948609 7:44823393-44823415 AAACCTAACCCCCTATAGAGTGG + Intronic
1024524549 7:50337019-50337041 CAGGATAATGCCCTAGAAAGAGG + Intronic
1026110033 7:67451720-67451742 CCACCTCCTCCCCTAGAGAGAGG - Intergenic
1029839309 7:103345255-103345277 CAATCTAACACACTAGAGAGAGG - Intronic
1035278070 7:157759856-157759878 CCAGCTCCTCCCCAAGAGAGGGG - Intronic
1037737356 8:21578451-21578473 CAAGGTATTCCCCTAGGGAAGGG + Intergenic
1038535141 8:28348397-28348419 CAAGCTAATCCCCTAGAGAGTGG + Exonic
1048253507 8:132886933-132886955 GAATCTAATCCCACAGAGAGTGG - Exonic
1049334895 8:142078777-142078799 CAAGTTTACCCCCTAGAGAACGG - Intergenic
1059183486 9:112242967-112242989 CAATCTAATCCACTAGGGAAAGG - Intronic
1060264428 9:122102209-122102231 CAAGCTAATCTCCCAGGGACAGG - Intergenic
1061616734 9:131785283-131785305 CAAGCTAATCCCTCATGGAGGGG - Intergenic
1188416697 X:29944178-29944200 CAAGTTATTCCCCTAAAAAGCGG + Intronic
1188705140 X:33318940-33318962 AAAGCTAATCCCCAAGAGGTTGG + Intronic
1195792990 X:108609777-108609799 CAAAGTAATCCAATAGAGAGGGG - Intronic
1199529773 X:148833237-148833259 CATGCGAATCACCTTGAGAGGGG - Intronic
1199776176 X:151013657-151013679 CATGCTAATCGCCAAGACAGTGG - Intergenic