ID: 1038540376

View in Genome Browser
Species Human (GRCh38)
Location 8:28385917-28385939
Sequence CCCCGCGCGCCCGCGGCTGT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 164
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 145}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1038540376_1038540382 9 Left 1038540376 8:28385917-28385939 CCGACAGCCGCGGGCGCGCGGGG 0: 1
1: 0
2: 0
3: 18
4: 145
Right 1038540382 8:28385949-28385971 TTCGCGGCCGCCCCCGTCCCCGG No data
1038540376_1038540388 25 Left 1038540376 8:28385917-28385939 CCGACAGCCGCGGGCGCGCGGGG 0: 1
1: 0
2: 0
3: 18
4: 145
Right 1038540388 8:28385965-28385987 TCCCCGGCTGCCGCGCCGCTAGG No data
1038540376_1038540381 -7 Left 1038540376 8:28385917-28385939 CCGACAGCCGCGGGCGCGCGGGG 0: 1
1: 0
2: 0
3: 18
4: 145
Right 1038540381 8:28385933-28385955 CGCGGGGCGTGGGAAGTTCGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1038540376 Original CRISPR CCCCGCGCGCCCGCGGCTGT CGG (reversed) Intronic
900244378 1:1630713-1630735 CCCCGCCCGCCCCAGGCTCTCGG + Intergenic
900787067 1:4655724-4655746 CCAGGCGCGCCCGCAGCTCTAGG + Intronic
901443536 1:9293314-9293336 CCCCGCGCTGCCGCCGCTGCAGG + Intronic
901641519 1:10695218-10695240 CCCCGCGCGTCCCCGGCCCTGGG + Intronic
906627141 1:47334262-47334284 CGCCGCGCGCCGGCGGCCCTCGG - Intronic
907276438 1:53319448-53319470 CCCAGCGAGCCCAGGGCTGTGGG - Intronic
910138431 1:83999211-83999233 CCCCCGGCGCCCGCGCCTCTCGG - Intergenic
915519904 1:156436122-156436144 CCCGCCGCGCCCGCGGCCGGAGG - Intergenic
916694597 1:167221894-167221916 GCCCGCGCGCCCCCGGCCGGCGG + Intronic
920027229 1:203007653-203007675 GCTCGCGTGCCCGCGGCTGGAGG + Intronic
920401567 1:205679845-205679867 CCCCGCGGCGCCGCGGCCGTCGG + Intronic
921850516 1:219928445-219928467 CGCCGGGCGCCCGGGGCTGGTGG - Exonic
922196580 1:223364507-223364529 GCCCGCGCGCCTGCACCTGTCGG + Intergenic
922602841 1:226870484-226870506 CCCCGCGCGCCCGGGACTCCAGG + Intronic
922739419 1:228007004-228007026 ACCCGCGCACCCGCGGCCGCAGG + Intergenic
922783319 1:228269979-228270001 CCCGGCGCGGCCGCGGCCGGGGG - Intronic
924090105 1:240492923-240492945 CCCCGCGCGCGCCCGGCCGCTGG - Exonic
1063115440 10:3068599-3068621 CCCGGCGCGCCCGCGTCCGTGGG - Intronic
1065099107 10:22316329-22316351 CCGCGCGCGCACGCGGCTCGGGG - Exonic
1067028704 10:42866121-42866143 CCCCGCGAGCTCGCGGCGGCCGG - Intergenic
1070329001 10:75404872-75404894 GCCTGCGCGCCCGGGGCTTTTGG + Intergenic
1070768159 10:79068232-79068254 CCCCGCTCCCCCACAGCTGTCGG + Intergenic
1072089639 10:92115043-92115065 TCCCCCGCGCCCGCGGCCGCCGG - Intronic
1073178493 10:101570367-101570389 CCTCGCGCGCCCTCTGCTGGCGG + Intergenic
1074088344 10:110225883-110225905 CCGCACCCGCCCGCGGCTGCCGG - Intronic
1076035696 10:127196765-127196787 CCCCGCGCGCAGGCGGCAGCCGG - Intronic
1077962389 11:7089416-7089438 CCTCGGGCGACCGCGGCTGCGGG - Exonic
1081968889 11:47185420-47185442 CCCGGTGCGCCCGCAGCTCTAGG + Intronic
1083610041 11:64000197-64000219 CCCGACGCGCCCCCAGCTGTGGG - Intronic
1083922068 11:65786589-65786611 CCCGGCGCGCCCGAGGCTCCTGG - Intergenic
1085038674 11:73314326-73314348 CCCCCCGCCCCCCAGGCTGTAGG + Intronic
1091823641 12:3493534-3493556 CCCCGCGCGGCAGCGGGGGTAGG - Intronic
1092278496 12:7081186-7081208 GCCCCCGCGCCCGTGGATGTTGG + Exonic
1092286035 12:7129821-7129843 CCCCTCGCGCACGCACCTGTCGG - Intronic
1093972335 12:25386371-25386393 CCCCGCGTGCCCGCAGAAGTGGG - Intergenic
1096024807 12:48351097-48351119 ACCTCCGCGCCCGCCGCTGTGGG + Intronic
1096977529 12:55707960-55707982 CCCCTCGCTCCCGCGGCAGGTGG + Intronic
1097872066 12:64610333-64610355 CCCCGCCCGCCCGCAGGTGGGGG - Intergenic
1098595765 12:72272309-72272331 CCCTGCGCGCCTGCGGCTCCCGG - Intronic
1099989559 12:89708561-89708583 CGCCGCCCGCCCGCGGCCGGGGG - Intronic
1100315473 12:93441485-93441507 TCCCGCGCGCCCGCGGCCTCCGG + Intronic
1101037193 12:100717342-100717364 CCCCGCGCGCCGGCAGCTCTAGG + Intergenic
1104933416 12:132352262-132352284 CCCTGCACGGCCGCGGCTGCTGG + Intergenic
1104989695 12:132618732-132618754 CGCCGCGCGCCCCCCGCTCTCGG + Intergenic
1106108922 13:26760381-26760403 CCCCGTGCGCACGGGGCAGTCGG + Intronic
1106241585 13:27917750-27917772 ACCCGGGTACCCGCGGCTGTGGG - Intergenic
1107549045 13:41457963-41457985 CCGCGCGCGCCCGGGGTTGGGGG + Intronic
1110119537 13:71865567-71865589 GCCCGCGCGCCCGGGGCAGGGGG + Intronic
1119330158 14:73787351-73787373 CTCTGCGCGCCCTCGGCTGCGGG + Intronic
1120190528 14:81436118-81436140 CCCGGGACGCCCGCGGCTGGTGG + Intronic
1121330495 14:93046580-93046602 CCCCCCCCGCCCCCGGCTGCTGG - Intronic
1122486837 14:102087381-102087403 CTCCGCCCGCCCGCGGCAGGTGG - Intronic
1126150868 15:45522717-45522739 CCCGCCGCGCCCGCTGCTGGAGG + Exonic
1130335291 15:82952710-82952732 CCCCGCCCGCCCGCGCCTGGCGG - Exonic
1130908434 15:88255643-88255665 CCCCGCGTGCCCTCGGCGGCCGG + Intronic
1130967125 15:88705646-88705668 ACTCGGGCGCCCGCGGCGGTGGG + Intergenic
1131055343 15:89371542-89371564 CCCCGCGCCCTCGAGGCTGCGGG + Intergenic
1132252017 15:100341474-100341496 CCCCGCGCTGGCGCGGCTGGCGG - Intronic
1132326336 15:100973473-100973495 CCCTGCGCCTCCGCTGCTGTCGG + Intronic
1132719458 16:1308849-1308871 TCCCGCGCGCTCGCGGGTCTGGG + Intergenic
1132841522 16:1980482-1980504 CCTGGCGCGCCTGCAGCTGTTGG - Exonic
1133021465 16:2968796-2968818 CCTCACGCGCCCGCAGCCGTCGG - Intronic
1134529890 16:14975087-14975109 TCCCCCGCGCCCGCGGCCGGCGG - Exonic
1136505318 16:30699044-30699066 GCCCGCGCGTGCGCGGCTGGAGG - Intronic
1138651460 16:58463684-58463706 CTCCGCGTGCCCGCGGCTGCAGG - Intronic
1142556537 17:782130-782152 CCTCGCGCGCCAGCCCCTGTCGG + Intronic
1143053129 17:4142965-4142987 CCCCGCCCGCCAGCTGCTGTCGG - Exonic
1145969664 17:28949697-28949719 GCCCGCGCGCCCGCTGCCCTCGG - Intronic
1150268788 17:63849271-63849293 CCTCGCGCGCCCCCGCCTGGCGG + Intergenic
1151700189 17:75738655-75738677 CCCTGCCCGCCCGCAGCTGGCGG + Intronic
1152283075 17:79396726-79396748 CCCCTCGGGCCCCAGGCTGTGGG + Intronic
1152485091 17:80585574-80585596 CACCGTGTGCCCGGGGCTGTAGG - Intronic
1152714365 17:81891437-81891459 CCCAGGGCGGCCGCGGCGGTGGG - Exonic
1153070412 18:1098504-1098526 CTCCCCCCGCCCCCGGCTGTAGG + Intergenic
1153382251 18:4454000-4454022 CCGCGCTCGCCCCCGGCTGCAGG - Intronic
1153457222 18:5295269-5295291 CCCCGCCCTCCCGCGGCCGGGGG + Intronic
1153565609 18:6414727-6414749 CCCCGCGCGGCGGCGGCCGTGGG + Intronic
1157492812 18:48136203-48136225 GCCCGGGCGCCCGCGGGAGTGGG + Intronic
1160392183 18:78542388-78542410 CCCTGCCCTCCCGCGGCTCTTGG - Intergenic
1160729258 19:633350-633372 CCCCGCGCGGCCGGGGCCTTTGG - Intronic
1161108799 19:2457019-2457041 CCCCGCGCGCGCCCGGCGGTCGG - Intergenic
1162027795 19:7904189-7904211 CCCCGCGAGCCCGCAGCGGGGGG - Intronic
1163807260 19:19406501-19406523 CCCCGCGCGCCCACGCCTGGAGG + Intronic
1165311448 19:35031165-35031187 CACCCCCCTCCCGCGGCTGTGGG - Intronic
1166792548 19:45406576-45406598 CCCCGCGCTCCCGCACCAGTTGG + Exonic
1167080780 19:47274951-47274973 CCCCGCGCCTCCGGGGCTCTCGG - Exonic
1168063856 19:53908652-53908674 CTGCGCCCGCCCGCTGCTGTAGG + Intergenic
926094628 2:10073212-10073234 CCCCCCCCCCCCCCGGCTGTGGG + Intronic
929151141 2:38750497-38750519 CCCGGTGCGCCCGGGGCTGCCGG - Intronic
930785593 2:55268930-55268952 CCCTCCTCGCGCGCGGCTGTGGG - Intronic
933093025 2:78145649-78145671 CCCCGGGAGCCCGCTGCTGTGGG + Intergenic
934966844 2:98731061-98731083 CGCCGTGCTCCCGCGGCTGCCGG + Intronic
935059302 2:99593817-99593839 CCCAGCGCGTCCGCGGCCGCGGG + Exonic
936713612 2:115161428-115161450 ACCCGCGCGCCCACGGCCGCCGG - Intronic
941096686 2:161245164-161245186 CCCGGCGCGGCCGCGGCCGGGGG - Intergenic
942116695 2:172735672-172735694 CCCCGCGGTCCCGCTGCTGGGGG - Intronic
942678229 2:178450836-178450858 GCCCACGCCTCCGCGGCTGTGGG - Intronic
942748759 2:179264774-179264796 CCCCGCGCGCGCCCGGGTGACGG + Exonic
945649259 2:212538609-212538631 CCCCACGCGCGCCCGGCTGGGGG - Exonic
947212116 2:227717988-227718010 GACCACGCACCCGCGGCTGTCGG + Exonic
948645334 2:239400760-239400782 GCCCGCGCGCCGGCGGGTGGCGG - Exonic
1174804603 20:53594210-53594232 CGCCGCGCCCCGGCGGCTCTAGG - Intronic
1175920228 20:62447131-62447153 CCTGGCGCGCCCTCGCCTGTGGG + Intergenic
1175926776 20:62475195-62475217 CCCCGCGCTGCCGCCGCTGCCGG + Exonic
1176547884 21:8209256-8209278 CCTCGCGCGCCCGCGGGCGCCGG + Intergenic
1178992196 21:37366194-37366216 CCCCGCGCGCCCGGGCCTGGAGG - Intronic
1179561727 21:42219709-42219731 AGCCCCGCGCGCGCGGCTGTGGG + Intronic
1179784054 21:43719692-43719714 CCGCCCGCCCCCGCGGCAGTTGG - Intronic
1180699655 22:17774384-17774406 GCCCGCGCCCCCGCGGCTGGAGG - Intronic
1181026776 22:20131608-20131630 CGGCGGGCGCCCGCGGCTCTCGG - Intronic
1181574895 22:23787373-23787395 GCGCGCGCGCTCGGGGCTGTGGG + Intronic
1184663452 22:45976056-45976078 CCCCGCCCGCCCGGGGCCCTGGG - Intronic
1185321419 22:50201703-50201725 CACCGCGCTCCCGCGGGTGCAGG - Intronic
950729827 3:14947765-14947787 CCCCGCGAGCCCGCGGCCCCCGG + Intronic
952942571 3:38455092-38455114 CTCAGCTCGCCCGCGGCTGCGGG + Intronic
953183231 3:40615701-40615723 CCCCGCGCGCCTGCTGCAGGGGG + Intergenic
953404662 3:42654477-42654499 CCCGCCGCGCCCGAGGCTCTGGG + Intronic
954400995 3:50319578-50319600 CCCCGTGAGCCTGCGGCTGTAGG + Exonic
958692109 3:97481540-97481562 CGCCGCGCCCCGGCGGCTCTAGG - Intronic
961827329 3:129606029-129606051 CCCCCCGCGCCCGCGGCGGGAGG + Exonic
963827294 3:149970215-149970237 CCTCCCGCGCCTCCGGCTGTGGG - Intronic
965977342 3:174641211-174641233 CCCCGAGCGCACGTGGTTGTGGG - Intronic
968235917 3:197029899-197029921 CCCGGCGCGCCCCCTGCTGGAGG + Intergenic
981348318 4:143700262-143700284 CCGGGCGCGTCCGGGGCTGTGGG + Exonic
981528754 4:145733023-145733045 GCCCCCGCCCCCGCGACTGTCGG - Intronic
984734753 4:183098961-183098983 CCCCGCGGGGCCGCGGCTCCAGG - Intergenic
985995778 5:3596161-3596183 CCCCGGGCGCTCGCCGCCGTAGG - Exonic
986330724 5:6714263-6714285 CGCCGCGCGCCCTCGGCCGCGGG - Intergenic
992487591 5:77210878-77210900 CCGCCCGCGCCCGCGGCCGCCGG - Exonic
996329361 5:122312086-122312108 CCCCGCCCGCGCGCGCCCGTTGG + Exonic
998083356 5:139294468-139294490 CCGCGCGCGCGCGCGCGTGTGGG - Intronic
999462910 5:151772166-151772188 CCGCGCGCGCCTGCGGCCGTTGG - Intronic
1002645041 5:180648923-180648945 CACCGCGCGCCCGAGGCGGACGG - Intronic
1007473397 6:42104808-42104830 CCCGGGGCGCCCCCGGCTCTCGG - Exonic
1011459688 6:87590104-87590126 CCGCGCGCCCTCGCGGCTGCAGG - Intronic
1017324373 6:153130051-153130073 CCTCGCGAGCCCGAGGCTGCTGG - Intronic
1019516407 7:1442142-1442164 CCCCGGGGGCCCGCAGCTCTGGG - Intronic
1019619444 7:1983125-1983147 GCGCGCGCGCGCGCGTCTGTGGG - Intronic
1022094440 7:27130196-27130218 CCCCGCGTGCCCGCTGCTCTTGG - Exonic
1022715192 7:32892006-32892028 TCGCGCGCGCGCGCGCCTGTCGG + Intronic
1023810326 7:43906520-43906542 CCCTGCGCCCCCGCGGCTGCCGG - Intronic
1026004830 7:66592286-66592308 CCCCGCTCGCCCGCGTCGTTCGG + Intergenic
1034446288 7:151115723-151115745 CCGCGCGCGTCCGGGGCTGGCGG + Intronic
1035022683 7:155808602-155808624 CTCCGCGCGGCCTCGGCTGGCGG + Intronic
1035212268 7:157337185-157337207 CCCCGCGCGCGCCCGGCAGACGG + Intronic
1035744624 8:1952700-1952722 CCCAGGGCACCAGCGGCTGTCGG + Exonic
1035833940 8:2728071-2728093 CCCCGCCCCCTCCCGGCTGTGGG + Intergenic
1038540376 8:28385917-28385939 CCCCGCGCGCCCGCGGCTGTCGG - Intronic
1038883675 8:31640333-31640355 GCCCGTGGGCCCGCGGCTGGCGG - Intronic
1040951208 8:52940359-52940381 CACCGCGCGCGCGGCGCTGTAGG - Exonic
1041712947 8:60910077-60910099 CCCTGCGCGCCCGGGGCAGGCGG + Intergenic
1042040021 8:64580692-64580714 CCCAGCTCGCGCGCGTCTGTGGG + Exonic
1046138463 8:110061079-110061101 CCCCGCGGCCTCGTGGCTGTTGG - Intergenic
1049719265 8:144108128-144108150 CCCCGCGCGCCCGCGCCCGCCGG + Exonic
1049752224 8:144290733-144290755 CCCAGCGCGGCCGCGGCCGAGGG + Intronic
1049843200 8:144787244-144787266 CCCCGCGCGCCCGCCCCCGCCGG + Intronic
1051170632 9:14315522-14315544 CGCGGCGCGCCCGGGGCTGCGGG + Intronic
1056532472 9:87498771-87498793 CCACGCGCGCGCGGGGCTGAGGG + Intronic
1057219256 9:93247231-93247253 CCCAGCGCCCCCGGGGCTGGTGG - Intronic
1057488787 9:95506689-95506711 ACCCGCGCCCCCACGGCTGTTGG - Intronic
1059414392 9:114154277-114154299 GCCCCCGCGCCCACGGCTGCGGG + Intergenic
1061129777 9:128702521-128702543 CGCCGCGCGCCCGCGGGAGCCGG - Exonic
1061366148 9:130173096-130173118 CCCCGCGCGCTCGTGCCAGTCGG - Intronic
1189002828 X:36963831-36963853 CCCCGCGCGCTCGGCGCTGGTGG - Intergenic