ID: 1038540502

View in Genome Browser
Species Human (GRCh38)
Location 8:28386333-28386355
Sequence GTGCGGGGGCGCGGAGGCGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 664
Summary {0: 1, 1: 0, 2: 13, 3: 83, 4: 567}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1038540502_1038540520 20 Left 1038540502 8:28386333-28386355 CCCGCGCCTCCGCGCCCCCGCAC 0: 1
1: 0
2: 13
3: 83
4: 567
Right 1038540520 8:28386376-28386398 GCGCCTGGGCTACACACCCCCGG 0: 1
1: 0
2: 0
3: 10
4: 118
1038540502_1038540514 5 Left 1038540502 8:28386333-28386355 CCCGCGCCTCCGCGCCCCCGCAC 0: 1
1: 0
2: 13
3: 83
4: 567
Right 1038540514 8:28386361-28386383 CAGCACGCCCCCAGCGCGCCTGG 0: 1
1: 0
2: 2
3: 11
4: 141
1038540502_1038540515 6 Left 1038540502 8:28386333-28386355 CCCGCGCCTCCGCGCCCCCGCAC 0: 1
1: 0
2: 13
3: 83
4: 567
Right 1038540515 8:28386362-28386384 AGCACGCCCCCAGCGCGCCTGGG 0: 1
1: 0
2: 1
3: 5
4: 74

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1038540502 Original CRISPR GTGCGGGGGCGCGGAGGCGC GGG (reversed) Intronic
900537123 1:3184394-3184416 GGGCGGGGGCCGGGAGGCGAGGG + Intronic
900581717 1:3412835-3412857 GGGCGGGGCCGCGGCGGTGCTGG + Intronic
900622846 1:3595305-3595327 GAGGGAGGGCGGGGAGGCGCAGG + Intronic
901109772 1:6785439-6785461 GGGCGGGTGCGCGGCGGCGGCGG + Exonic
901317214 1:8317358-8317380 GTGTGGGGCTGCAGAGGCGCTGG - Intergenic
901577247 1:10210805-10210827 GCGCGGGGGCGCGGGGGGCCGGG - Exonic
903596991 1:24502745-24502767 GGGCGGGGGCGCGCGGGGGCCGG - Intronic
903777123 1:25800291-25800313 GCGCGGCGGCGCGGTGGCGCGGG - Exonic
903907816 1:26697850-26697872 GTGAGGGGGTGAGGGGGCGCTGG + Intronic
904006675 1:27366596-27366618 ATGCGGGGGCGCTCAGGCGCGGG + Exonic
904467799 1:30718528-30718550 GGGCGGGGCCGGGGAGGAGCCGG - Intronic
904618951 1:31764146-31764168 GGGCGGGGGAGCGGGGGAGCGGG - Intronic
905414383 1:37794390-37794412 GTGCGGGGCGGCGGCGGCGGCGG - Exonic
907040121 1:51251427-51251449 GGGGGGGGGCCCGGAGGCCCTGG - Intronic
908501078 1:64744817-64744839 CTGTGAGGGCGCGGACGCGCAGG - Intergenic
908534758 1:65067153-65067175 GAGCGCGGGGGCGGCGGCGCGGG - Intergenic
910676623 1:89821806-89821828 GGGCGGGGGCGGGGAGGTGAAGG + Intronic
911633986 1:100213387-100213409 CTGCGGGGGCGCGGCGGGGATGG - Intronic
912492697 1:110070701-110070723 GCGCGGGGGCGCGGAGCCCCCGG + Intronic
912716830 1:111989374-111989396 GTGGGTGGGCGCTGGGGCGCCGG - Intergenic
915253524 1:154608091-154608113 GTGCGGAGTAGCGGAGGCGTGGG - Exonic
915549704 1:156625000-156625022 GTGCGGGACCGCAGAGGTGCTGG - Intronic
915977569 1:160400874-160400896 GTGCCGGGCCGCGGGGGCGCGGG + Intronic
916102616 1:161406100-161406122 GGGGGGGGGCCCGGAGGCCCTGG + Intergenic
916651767 1:166839896-166839918 GCCCGGGGGCGCGGCGGCGGTGG + Intronic
916666994 1:166975589-166975611 GGGCGGCGGGGCGGAGGCGCGGG - Intronic
917797525 1:178542735-178542757 CGGCGGGGGCGCGGGGGCGTCGG - Intronic
917962302 1:180154774-180154796 GGGCGGGGGCTCGGGGGCGGGGG + Intergenic
919895707 1:202008455-202008477 GTGCGGGGGCGGGGGGGCGGGGG + Exonic
920190659 1:204191668-204191690 GTGCCAGGGCACGGAGGAGCAGG - Intronic
920394173 1:205631840-205631862 GTGCGGGGGCGGGGAGGGCGGGG - Exonic
920572132 1:207025084-207025106 GGGCGGGGGCGGGGAGGCGGGGG + Intronic
922373007 1:224929924-224929946 CTGCGTGGGCGCGGAGGGCCTGG + Intronic
922804522 1:228378490-228378512 GTGGGGGGGCGGGGCGGGGCGGG - Intronic
922821407 1:228487919-228487941 GGGCGGGGGCGGAGAGGCGCAGG - Intronic
922925128 1:229342153-229342175 GCGCGGGGCCCCGGAGGAGCAGG - Exonic
923400760 1:233614037-233614059 GGGCGGGCGCGCGGGGGAGCGGG + Exonic
923401573 1:233619921-233619943 GGGCGGGGGGGCGGGGGGGCAGG + Intronic
923505269 1:234600139-234600161 GGGCGGCGGAGCGGAGGGGCGGG + Intergenic
924659441 1:246002894-246002916 GTGGCCGGGCGCGGAGGCTCAGG - Intronic
1062857516 10:786651-786673 GTGCGGGGGCGGGGTGGGGCGGG + Intergenic
1063458957 10:6203455-6203477 GCGGGGCGGGGCGGAGGCGCGGG + Intronic
1063582909 10:7325247-7325269 GGGTGGGGGCGCGGTGGCTCAGG - Intronic
1064230919 10:13528878-13528900 GGGCCGGGGCGCGGCGGCGGCGG + Intronic
1065025063 10:21534015-21534037 GCGCGGGGGCGCGCACGCGGGGG - Intergenic
1066004456 10:31133956-31133978 GGGAGGGGGCGAGGAGGGGCAGG - Intergenic
1067116178 10:43437088-43437110 GGGCGGGGCCGCCGAGGGGCGGG - Intronic
1067382363 10:45786778-45786800 GTGCAGGGGAGGGGAGGCGGGGG - Intronic
1067890063 10:50127326-50127348 GTGCAGGGGAGGGGAGGCGGGGG - Intronic
1069761834 10:70816321-70816343 GCGCGGGGCCGCGGTGGGGCGGG + Intronic
1070954264 10:80454232-80454254 GCGGAGGGGCGCGGAGGGGCGGG - Exonic
1071532390 10:86400341-86400363 GAGCGGGAGGGCGGAGGCGGCGG + Intergenic
1071618199 10:87095032-87095054 CGTCGGGGGCGCGCAGGCGCGGG + Intronic
1073088531 10:100912703-100912725 GCGCGGGGGCGGAAAGGCGCGGG - Intronic
1073306045 10:102504181-102504203 GGCCGGGGGCGCGGTGGGGCCGG - Exonic
1073441461 10:103555220-103555242 GTGGGGGCGCGTGGGGGCGCGGG + Intronic
1074382540 10:112992330-112992352 GGGCTGGGGGGCGGAGGCGAGGG - Intronic
1075618718 10:123910156-123910178 GTGCAGGGGCGCGAATGTGCAGG - Intronic
1075629391 10:123991928-123991950 GTGCGGGGGCCCGGCGCCGAGGG - Intergenic
1076336709 10:129711477-129711499 GTGGGAGGGCGCTGAGGCTCTGG + Intronic
1076373910 10:129971355-129971377 GTGCGTCGGCGCGGGGGCGGGGG + Intergenic
1076880884 10:133238532-133238554 GTGCTGGGGGGCGGGGGCGGGGG - Intronic
1076909219 10:133379100-133379122 GGGGAGGGGCGGGGAGGCGCGGG - Intergenic
1076909229 10:133379120-133379142 GGGGAGGGGCGGGGAGGCGCGGG - Intergenic
1076909239 10:133379140-133379162 GGGGAGGGGCGGGGAGGCGCGGG - Intergenic
1076909265 10:133379190-133379212 GGGGAGGGGCGGGGAGGCGCGGG - Intergenic
1076909281 10:133379220-133379242 GCGAGGGGGCGGGGAGGCGCTGG - Exonic
1077015632 11:397967-397989 GTGCGGGGGTACGGAGGTGACGG - Intronic
1077015661 11:398083-398105 GTGCGGGGGTACGGAGGTGACGG - Intronic
1077015724 11:398341-398363 GTGCGGGGGTACGGAGGTGACGG - Intronic
1077015838 11:398776-398798 GTGCGGGGGTACGGAGGTGACGG - Intronic
1077021899 11:420695-420717 GTGCGTGGGCGCTGCGGGGCGGG - Intronic
1077065538 11:639563-639585 GCGCGGGGGCGCCGGGGCGCGGG - Intronic
1077404566 11:2377398-2377420 GCGCGGGGGCGCGGGGGCGCGGG - Exonic
1077404695 11:2377769-2377791 GTCGGGGGGCGCGGTGGCCCCGG - Intronic
1077891266 11:6419427-6419449 GTGCGGCGCCGCGGCCGCGCGGG + Intergenic
1078352686 11:10607601-10607623 GTGCTGGGGCGGGGAGGCCTGGG + Intronic
1078771956 11:14359220-14359242 ATGAGGGGGCGGGGAGGGGCGGG + Intronic
1079035135 11:17014260-17014282 GGGTGGGGGCGCGGGGGCGGGGG - Intronic
1079058550 11:17228291-17228313 GTTGGGGGGCCCGGAGGCCCTGG + Intronic
1079076738 11:17389198-17389220 GGGAGGGGGCGGGGAGGCGACGG - Intronic
1079408156 11:20163022-20163044 GGGCGGGGGCGAGGGGGCGAGGG + Intergenic
1079708654 11:23653279-23653301 TGGCGGGGGCGGGGAGGCTCAGG + Intergenic
1080387581 11:31818971-31818993 GTGGTGGGGCCCGGAGGGGCAGG + Intronic
1081492947 11:43581246-43581268 GTCCAGGGGCGCGGAGGGGCGGG + Intronic
1082787420 11:57324632-57324654 GCGCGTGTGCGCGGAGGCGGAGG - Intronic
1083419760 11:62546212-62546234 TCGCGGAGGCGCGGAGGCGCTGG + Intronic
1083638031 11:64130698-64130720 GTGCGGCGGCGGGGAGGCAGCGG - Intronic
1083660019 11:64247565-64247587 GGGCGGGGGAGGGGCGGCGCCGG - Intergenic
1083766804 11:64845143-64845165 GGGCGGGGGCGGGGGGGCGATGG - Intergenic
1083995225 11:66268452-66268474 GGGAGTGGGCGCGGAGGCGCGGG + Intergenic
1084173515 11:67411633-67411655 CTGCGGGGGCGCGGTGGCAGTGG + Intronic
1084208290 11:67608649-67608671 TTGAGGGGCCGTGGAGGCGCTGG + Exonic
1084310259 11:68312613-68312635 GAGGGGGGAGGCGGAGGCGCCGG + Exonic
1084319168 11:68363974-68363996 GTGCGGGGGCTGGGGGGAGCGGG + Intronic
1084332869 11:68439922-68439944 GGGCGGGGCCGGGGAGGGGCGGG + Intronic
1085574423 11:77589761-77589783 GCGGGGAGGCGGGGAGGCGCGGG - Exonic
1087761745 11:102110376-102110398 AGGCGGGGCCGCGGCGGCGCGGG + Intergenic
1088686738 11:112290200-112290222 GTGCCGGGGGGCGGGGACGCGGG + Intergenic
1089298622 11:117484398-117484420 GTGCGGGGGCCTGGAGGCCAGGG - Intronic
1091558565 12:1594088-1594110 GCGCTGGGGGGAGGAGGCGCGGG + Exonic
1091558671 12:1594423-1594445 GGGCGTGGGCGCGGCGGCGCGGG - Intronic
1091558811 12:1594843-1594865 TTGCGCGGGCGCGGGGGAGCGGG - Intronic
1091616202 12:2052926-2052948 GGGCGCGGGCGCGGCGGGGCTGG + Intronic
1093958677 12:25250559-25250581 GCGCGCGGACGCGGCGGCGCGGG - Intronic
1094051670 12:26226984-26227006 GGGCGGAGGCGCGGTGGCCCCGG - Intronic
1096647635 12:53047332-53047354 GGGCGGGGGCGCGGCGGGGCGGG - Intronic
1096732556 12:53626150-53626172 GGACGGGGGCGCTGAGGCGGTGG - Intronic
1097158081 12:57027116-57027138 GAGCGGGGGCGATGAGGCGCAGG + Intronic
1098161067 12:67648731-67648753 GCGCGGGGGCGCGCGCGCGCGGG + Exonic
1098893479 12:76032011-76032033 GGACGGGGGCGCGGAGGCGGGGG + Exonic
1098943152 12:76559872-76559894 GTGACGGTGCGCGGAGGCGGTGG + Intergenic
1100404707 12:94263195-94263217 GGCCGGGGGCGGGGAGGCGGTGG - Intronic
1101970720 12:109310084-109310106 GGGCGGGGCAGCGGCGGCGCGGG - Intergenic
1102278392 12:111599519-111599541 GGGCGGGCGCGCCGAGGCGCCGG + Exonic
1102375715 12:112419290-112419312 GGGTGGGGGCGCGGTGGGGCCGG - Intronic
1102471392 12:113161786-113161808 GGGCGGGGGCGGGGAGGAGGGGG - Intronic
1102652062 12:114448996-114449018 GGGCGGGGGCGGGGGGGTGCGGG - Intergenic
1103107818 12:118246105-118246127 GCGGGGGGGCACGGAGGCCCTGG + Intronic
1103595502 12:122022416-122022438 GCGCGGCGGCCCGGAGGCGGCGG + Intronic
1103749866 12:123151150-123151172 GCGCGGGGGAGCGGCGGCGGCGG + Intergenic
1103856480 12:123973595-123973617 GTGCGGGGGAGCGGGGCCGGGGG + Exonic
1103935588 12:124474873-124474895 CTGCGGGGGCGGGGAGGTGGTGG - Intronic
1104026595 12:125032044-125032066 GAGCGGGGGCGGTGAGGCACTGG + Intergenic
1104624008 12:130338174-130338196 GTGCGGGGGCCGGGATGCGGGGG + Intronic
1104906091 12:132214237-132214259 GTGAGGGAGGGCGGAGTCGCTGG - Intronic
1104929249 12:132329473-132329495 GTGAGGGGGGCCGGGGGCGCCGG + Intergenic
1105388875 13:19958193-19958215 GGGCGAGGCCGGGGAGGCGCTGG - Intergenic
1106087735 13:26558087-26558109 GGCCGGAGGCCCGGAGGCGCGGG - Intronic
1107851485 13:44576788-44576810 GGGCGGGCGCGCAGAGACGCCGG + Intronic
1108408305 13:50125434-50125456 GGGGGCGGGCGCGGCGGCGCGGG - Intronic
1108637624 13:52351365-52351387 GTGGTCGGGCGCGGAGGCGCAGG - Intergenic
1110630144 13:77698065-77698087 GTGCGGGGCGGCGGCCGCGCTGG - Intronic
1112287165 13:98114341-98114363 GTGCGGGGGCTGGGGGGCGGTGG + Intergenic
1112290903 13:98143394-98143416 GGCCGAGGGCGCGGCGGCGCCGG - Intronic
1112507165 13:99982013-99982035 TCGAGGCGGCGCGGAGGCGCAGG + Exonic
1112752558 13:102597220-102597242 GGGCCCGGGCGCGGGGGCGCGGG + Intronic
1113082873 13:106535728-106535750 GCGCGCGGCCGCGGAGCCGCGGG - Intergenic
1113473216 13:110561536-110561558 GGGAGAGGGCGCGGGGGCGCTGG - Exonic
1113655742 13:112067093-112067115 TGGCGGGGGGGGGGAGGCGCAGG - Intergenic
1113775632 13:112943465-112943487 GGGCCGGGGCGCGGCGGCCCGGG + Intronic
1113820660 13:113209878-113209900 GAGCGGGGGCGCCGGGGCGCCGG + Intronic
1113914735 13:113863601-113863623 GTGCAGCCGCGAGGAGGCGCGGG - Exonic
1115197027 14:30812341-30812363 GGAAGGGGGCGCGGGGGCGCCGG + Intergenic
1117119708 14:52553622-52553644 GGGCGGGTGCGCGGGGCCGCCGG + Intronic
1117680647 14:58199954-58199976 GTGCGGGGGCGCGGAGGCCGCGG - Intronic
1117875984 14:60249877-60249899 GGGCGGTGGCGGGGAGGCGGGGG + Intronic
1117964064 14:61189140-61189162 TCGCGGGGGCGCTGGGGCGCTGG - Intronic
1118796961 14:69152720-69152742 GGGAGGGTGCGGGGAGGCGCGGG + Intronic
1119290395 14:73491037-73491059 GTGCAGGGCCGTTGAGGCGCGGG + Exonic
1119403250 14:74378560-74378582 GCGCGGGGGCCCGGAGGCCCTGG - Intergenic
1121183582 14:91947716-91947738 GTGCGGGGGCTGGGAGGGCCCGG + Exonic
1121226176 14:92323396-92323418 GCGAGTGGGCGCGGCGGCGCGGG + Intronic
1121368016 14:93332625-93332647 GGGCTGAGGCGCGGCGGCGCCGG - Intronic
1121509464 14:94501653-94501675 GTGGGGGGGCGGGGAGGTGGTGG - Intronic
1122117765 14:99536222-99536244 GGGCGAGGGCTCGGAGGGGCTGG - Intronic
1122221235 14:100240060-100240082 CGGCGGGGGCGCGGCGGCGGCGG + Intronic
1122269685 14:100563030-100563052 GAGGGGGGGCGTGGAGGGGCAGG + Intronic
1122349222 14:101077949-101077971 GTGCAGGGGAGGGGCGGCGCAGG + Intergenic
1122470848 14:101964948-101964970 GTGCGGGGCCGCGGAGGGCAGGG + Intronic
1122552037 14:102555501-102555523 GTGGGTGGGCGCGGAGGCAGGGG - Intergenic
1123182399 14:106482486-106482508 GTGGGCGGGCGCGGCGGGGCGGG - Intergenic
1202944503 14_KI270726v1_random:14243-14265 GTGGGCGGGCGCGGCGGGGCGGG + Intergenic
1123684255 15:22786434-22786456 GTGAGGGGCCGGTGAGGCGCTGG - Intronic
1123787870 15:23690585-23690607 GTGCAGGGGCCCAGAGGCCCTGG + Intergenic
1124014219 15:25862606-25862628 GAGCGAGCGCGCGGTGGCGCAGG - Intronic
1124500347 15:30223034-30223056 TTGGGGGGGCGCGGCGGCGGCGG - Intergenic
1124504658 15:30262272-30262294 GTGCGGGGATGCGGAGCTGCAGG - Intergenic
1124696758 15:31870336-31870358 GGGCCGGGGCGCGGGGACGCGGG - Intronic
1124738894 15:32276363-32276385 GTGCGGGGATGCGGAGCTGCAGG + Intergenic
1124743226 15:32315632-32315654 TTGGGGGGGCGCGGCGGCGGCGG + Intergenic
1126102683 15:45129402-45129424 GTGGGGGGGCGCAGAGGAGGAGG - Intronic
1127224983 15:56918931-56918953 GTGGGGCGGCGCGGCGGGGCTGG + Intronic
1128582316 15:68818710-68818732 GTGCGGGGGCGCGGCTGGCCTGG - Intronic
1129016640 15:72474571-72474593 GGGCGGGGACGCCGAGGCCCCGG - Exonic
1129222023 15:74136557-74136579 GGGCGGGGGGGCGGATGGGCGGG + Exonic
1129440648 15:75578841-75578863 GCGCGGGGACGCGGAAGCGGAGG - Exonic
1129752821 15:78077685-78077707 CGGCCGCGGCGCGGAGGCGCAGG - Intronic
1130296163 15:82648067-82648089 GCGCGAGGGGGCGGAGGCGAGGG - Intronic
1130564526 15:84982078-84982100 CCGCGGCGGCCCGGAGGCGCCGG + Exonic
1131277465 15:90994253-90994275 GGCCGGGGGCGCTGAGGGGCAGG - Intronic
1131475384 15:92734215-92734237 GCGCGGCGGGGCGGAGGCGGAGG - Intronic
1131977567 15:97961206-97961228 CTGCGGGGCCGGGGAGGGGCTGG + Intronic
1132512625 16:352112-352134 GTGCGGGGGCCCGGGAGAGCCGG - Intronic
1132557503 16:579012-579034 GGGCGGGGGCGGGGCGGGGCGGG + Intronic
1132560201 16:590061-590083 GTGGGGCGGCGCGGCGGCCCTGG + Intronic
1132567722 16:630957-630979 GTGCGGGGGCTCCCAGGCCCTGG - Exonic
1132599554 16:767704-767726 GTGGGGGGGCGTGGAGGAGGAGG + Intronic
1132651430 16:1022998-1023020 GTGCTGGGACTCGGAGGAGCGGG - Intergenic
1132670602 16:1100806-1100828 GGGAGGGGGCGGGGAGGTGCGGG + Intergenic
1132670614 16:1100829-1100851 GGGAGGGGGCGGGGAGGTGCAGG + Intergenic
1132947131 16:2537951-2537973 GCGCGGGGGCGGGGCGGCGCCGG + Exonic
1132968558 16:2673452-2673474 GCGCGGGGGCGGGGCGTCGCGGG - Intergenic
1133018083 16:2954111-2954133 GTGCTGGAGCGCAGAGGGGCTGG - Intergenic
1133233293 16:4376397-4376419 GAGCGGGGGCCCGGAGTCTCAGG + Intronic
1133784573 16:8964058-8964080 GTGCCGGGGCGCGGCGCTGCGGG - Intronic
1134121342 16:11586854-11586876 GCGCGGGGACGCCGGGGCGCGGG - Intronic
1134134145 16:11668575-11668597 GGGCGGGGGCGCCGGGGCCCGGG + Intronic
1135109431 16:19679139-19679161 GGGCGGGGGTGGGGAGGCGGGGG + Intronic
1136367767 16:29816708-29816730 GTCCGGGGGCGAGGAGGCGCAGG + Exonic
1136478533 16:30527259-30527281 GAGCGGGCGCGCGCAGGTGCCGG - Intronic
1136636873 16:31529632-31529654 GAGCGGGGGCGGGGGTGCGCGGG + Intergenic
1137454715 16:48609693-48609715 CGGCGGGGGCGGGGAGGAGCGGG + Intronic
1137617624 16:49856689-49856711 GCGCGGGGGCGCTCAGGCGGCGG + Intronic
1139451353 16:67029853-67029875 GCGCGGGGCCGCGGCGGCCCAGG + Intronic
1140442635 16:74999293-74999315 GGGCGGGCGCGGGGAGGCGCCGG - Exonic
1141054657 16:80804127-80804149 GTACGGGGACGCGGGGGCGCGGG - Intronic
1141665294 16:85462683-85462705 CGGCGGGGGCGCCGCGGCGCGGG + Intergenic
1141677896 16:85527222-85527244 GTCCGTGGGCGCGCAGGGGCTGG + Intergenic
1142136288 16:88453378-88453400 GTGCGCGGGAGCGGAGGAGCCGG + Exonic
1142352665 16:89587178-89587200 CTGAGGGGGCGGGGAGGGGCGGG - Intronic
1142614838 17:1128088-1128110 GTGCTGGTGGGCGGAGGCCCAGG + Intronic
1142623784 17:1180054-1180076 GTGCGGGGGCGGGGCGGGGAGGG + Intronic
1142848129 17:2691926-2691948 GGGCGGGGCCGCGGGGGCACGGG - Intronic
1142848140 17:2691948-2691970 GGGCGGGGGCGTGGCGGGGCGGG - Intronic
1143024075 17:3930587-3930609 GTGCGGGGTCGGGGCGGCGGTGG + Intronic
1143127962 17:4656643-4656665 GAGCGGGGGTGGGGAGGCTCAGG + Intergenic
1143174513 17:4948555-4948577 GGGCGGGGGGGGGGAGGAGCAGG - Exonic
1143188460 17:5024232-5024254 GTGCTGGGGCAGGGAGGCCCAGG + Exonic
1143635762 17:8163009-8163031 GGGCGGGGGCGGGGCGCCGCGGG + Intronic
1144656861 17:17042513-17042535 CTGCGGCGGCGCGGACGAGCCGG + Intergenic
1145023041 17:19446809-19446831 GCGGGGGGGCCCGGAGGCCCTGG - Intergenic
1145077509 17:19867855-19867877 GCGCGGGGCCGCGGCGGTGCGGG - Exonic
1145786524 17:27597374-27597396 GTTGGGGGGCGTGGTGGCGCTGG - Exonic
1145828219 17:27893265-27893287 GGGCGGGGGCGCGGGGGCAGCGG - Intronic
1146057750 17:29589583-29589605 GAGCGGCGGCGGGGCGGCGCGGG - Intronic
1146322787 17:31859353-31859375 AAGCGGGGGCGGGGCGGCGCAGG + Intergenic
1146398540 17:32486913-32486935 GAGCGGGAGCGCGGCGGCGGCGG + Exonic
1147143735 17:38473676-38473698 GTGCGGGGGCGGGTGGGCGTGGG + Intronic
1147307425 17:39573704-39573726 CTGCGGGGGCACTGAGGAGCGGG - Intergenic
1147705375 17:42422043-42422065 ATGTGGGGGCGCGGGGGCGCAGG + Intronic
1147864957 17:43545983-43546005 GCGCGCGCGCGCGGAGGAGCAGG + Intronic
1147927070 17:43952803-43952825 GGGCGGGGGCACCGAGACGCGGG + Exonic
1148081245 17:44968513-44968535 GGGCGGGGCCGCGGAGACCCCGG + Intergenic
1148502319 17:48101214-48101236 GGGAGGGGGCGCGGCGGCGGCGG - Intronic
1148551915 17:48555664-48555686 GGGCGGGGGCGGGGGGGCGGGGG - Intronic
1148698813 17:49576303-49576325 GGGCGGGGGCCCGGAGGATCGGG + Intronic
1148722534 17:49764023-49764045 GGGCCGGGGCGCGGAGGGGCCGG - Exonic
1149512592 17:57256174-57256196 GATCGGGGGAGGGGAGGCGCGGG - Intronic
1150137612 17:62704201-62704223 GGGCGGCGGCGGGGAGCCGCGGG + Intronic
1151801530 17:76382476-76382498 GAGCTGGGGCCCGGAGGCGTTGG + Intronic
1151812453 17:76452695-76452717 GGGCGGGGGCTGGGCGGCGCGGG - Intronic
1152541916 17:80981141-80981163 CCGCGGGGGCGCGGGGGCGGGGG - Intergenic
1152551993 17:81034767-81034789 AGGCGGGGGCGGGGTGGCGCAGG - Intergenic
1152699528 17:81812122-81812144 GTGCTGAGGGGCGGAGGGGCTGG + Intronic
1152729194 17:81961467-81961489 GCGGGGGGGGGCGGCGGCGCCGG - Intronic
1152748509 17:82051983-82052005 GCGCGGGGGCGCGGAGGCCCGGG - Exonic
1153219436 18:2848159-2848181 GTGTGGGGTCGCGGGGGCGTAGG + Intronic
1153563773 18:6398740-6398762 TTGCGGGGGGGCGGGGGCGGGGG + Intronic
1153911278 18:9708343-9708365 GGGCGCGGGCGCGGCGGCCCCGG + Exonic
1155041113 18:22066232-22066254 GTGCCTGGGCGTGGTGGCGCGGG + Intergenic
1155054147 18:22170360-22170382 GTGCGGCGCCGCGGGGACGCCGG + Intronic
1155392614 18:25351812-25351834 GGGCGGGGGCGCGGCGCCGGCGG + Intronic
1155971937 18:32091805-32091827 GAGGCGGGGCGGGGAGGCGCAGG + Intergenic
1156452668 18:37275352-37275374 GGGCGGGGGCTCGGAGCCGGCGG + Intronic
1157222421 18:45837588-45837610 GTGCGGGTGCGTGAAGGTGCAGG - Exonic
1160164299 18:76496152-76496174 GGGCGGGCGCGCGGGGGCGGGGG + Intronic
1160204583 18:76822526-76822548 CGGCGGGGGCGCGCACGCGCGGG - Intergenic
1160525663 18:79533919-79533941 GTGCTGGGACCCGGAGGTGCTGG - Intergenic
1160551003 18:79693882-79693904 CTGCAGGGGAGCGGAGGGGCGGG - Intronic
1160668440 19:344519-344541 GTGCGCATGCGCGGCGGCGCGGG - Intronic
1160668519 19:344716-344738 GGCGGGGGGCGCGGACGCGCGGG + Intronic
1160726785 19:620961-620983 GGCAGGGGGCGCGGGGGCGCCGG + Intronic
1160726796 19:620982-621004 GGGGGAGGGCGCGGGGGCGCCGG + Intronic
1160738808 19:676601-676623 GTCGGGGGGCGCGGCGGCGGCGG + Intronic
1160752336 19:740304-740326 GTGCGGGGGCGGGCAGGCCGTGG + Intronic
1160860866 19:1236826-1236848 GGGAGGGGGCGCGGGGGCGGCGG + Intronic
1160862182 19:1242066-1242088 GTCCGGGGGCCCGGAAGCGGGGG - Intronic
1160896942 19:1407560-1407582 GGGCGGCGGCGCGGCGGCGCGGG + Intronic
1160930665 19:1568192-1568214 GGGCGGGGCGGCGGCGGCGCGGG + Intergenic
1160990106 19:1856970-1856992 GGGCAGGGGCGCGCAGCCGCTGG + Intronic
1160991814 19:1863267-1863289 GTGGGGCGCCGCGGCGGCGCCGG + Exonic
1161104154 19:2434936-2434958 GTGCGGGCGCGGGGCGGGGCGGG + Intronic
1161194325 19:2977683-2977705 CTGCAGGGGCGTGGAGGGGCAGG + Intronic
1161207206 19:3047301-3047323 GGGCGGGCGGGCGGAGGCGCGGG - Intronic
1161237154 19:3203890-3203912 GTGGGGAGGCACGGAGGCCCAGG + Intronic
1161265373 19:3361149-3361171 GTTCGGGCGCGAGGTGGCGCCGG + Intronic
1161273766 19:3404411-3404433 GGGAGGGGGCGCGGAGGCGTGGG + Intronic
1161428496 19:4217419-4217441 GTGCGAGGCCGCGGAGGCCGAGG + Exonic
1162741289 19:12775298-12775320 GTGCTGGGGCTGGGAGGTGCGGG - Intronic
1162808683 19:13151788-13151810 GGGGGGGGGCGCGGAGGGGCGGG - Intronic
1162818039 19:13207895-13207917 CTGCGGGGGCCCCGAGCCGCCGG + Exonic
1162893071 19:13747959-13747981 GTGCCGGCGGGCGGAGGAGCGGG + Intronic
1162931963 19:13961978-13962000 GGGCGGGGGCGCGGGGGCTGGGG + Exonic
1163127352 19:15251445-15251467 GGGGGGGGGGGCGGGGGCGCGGG + Intronic
1163138710 19:15332143-15332165 GCGCGGGGGCGGGGAGGCCGGGG - Intronic
1163288081 19:16361745-16361767 GTGGGGTGGCCCGGAGGCGGAGG + Intronic
1163304888 19:16471835-16471857 GTGCGGCGAGGCTGAGGCGCTGG - Intronic
1163329679 19:16628332-16628354 GCGCGCTTGCGCGGAGGCGCGGG - Intronic
1163547295 19:17947972-17947994 GGGCGGGGCCGCGGGGCCGCCGG + Intergenic
1163634964 19:18433474-18433496 GGGCGGGGGCGCGTCGGCGGGGG + Intronic
1163681203 19:18683646-18683668 GTGGGGGGGCGAGGAGGTGGAGG + Intergenic
1163725158 19:18919192-18919214 GCGCAGGGGCGCGGGGACGCTGG - Intronic
1163725161 19:18919200-18919222 GTGCGGCCGCGCAGGGGCGCGGG - Intronic
1164229248 19:23273610-23273632 GGGGGGGGGCGCTGAGGCACGGG + Intergenic
1164551142 19:29213173-29213195 GCGCAGGCGCGAGGAGGCGCGGG + Exonic
1164648137 19:29873744-29873766 GCGCGGGGGCGCGGGGGCGCTGG - Intergenic
1164648140 19:29873752-29873774 CGGCGCGGGCGCGGGGGCGCGGG - Intergenic
1165080220 19:33302497-33302519 GTGCGCGGGCGCGGGCGAGCAGG - Exonic
1165313482 19:35041669-35041691 GTGAAGGGGCGGGGAGGGGCCGG - Intronic
1165349828 19:35269381-35269403 GGGCGCGGGGGCGGGGGCGCGGG + Intronic
1165480660 19:36061763-36061785 GTGGGGGGGCGGTGAGGCACAGG - Intronic
1165774039 19:38394762-38394784 GAGCGGAGGAGCGGCGGCGCTGG - Exonic
1165924919 19:39320866-39320888 GGGAGGGGGCGCGGTGCCGCGGG + Intergenic
1166100860 19:40570634-40570656 GTGGGCGGTGGCGGAGGCGCGGG - Exonic
1166367261 19:42284056-42284078 GTGGCGGGGCGGGGAGGCGGTGG + Intronic
1166675317 19:44737491-44737513 GGGTGGGGGCGGGGAGGCGCTGG - Intergenic
1166830979 19:45639451-45639473 GGGCAGGGGCGCGGCGGCCCGGG - Intronic
1166931416 19:46303774-46303796 GTGCTGGGCCGCGGCTGCGCAGG - Intronic
1167072981 19:47231243-47231265 GGGCGGGGGCGGGGCGGGGCGGG - Intronic
1167258291 19:48443654-48443676 GTGGTGGGGCGCGGCGGCGGCGG - Exonic
1167368090 19:49065082-49065104 GGGCGGGGGCGGGGCGGCGCCGG + Intergenic
1167375267 19:49107797-49107819 GTGCGGAAGCGGGGAGGGGCCGG - Exonic
1167643707 19:50695096-50695118 GTACGGGGACGCGGCGGCGGCGG - Intronic
1167643781 19:50695247-50695269 GCCGGGGGGCGCGGGGGCGCGGG + Intronic
1168304746 19:55429387-55429409 GTGCGGGGCTGGGGAGGCCCTGG + Exonic
1168719068 19:58544913-58544935 GGGGGGCGGCGCCGAGGCGCTGG + Exonic
925730598 2:6917517-6917539 GCGCGGGCGCGGGGAGGCGCGGG + Exonic
926109105 2:10170790-10170812 GGGCGGGGGCGTGGGGGTGCGGG - Intronic
926300256 2:11596922-11596944 GTGAGAGGGGGCGGGGGCGCAGG + Intronic
926422933 2:12716835-12716857 GGGCGGGGGCGGGGCGGGGCCGG + Intergenic
927213198 2:20651115-20651137 GGGCGGGGACGCGGTGACGCGGG - Intergenic
927652280 2:24919990-24920012 GTGCGGGGGCCGGCAGGCGCGGG + Intergenic
927703072 2:25280307-25280329 GTGGGGGGGCGGGGAGGCGGGGG - Intronic
928143540 2:28751677-28751699 GTGCGGTTGCGCGGCGGCCCAGG + Intronic
929583708 2:43100889-43100911 GTGCGGCGGCGCGGAGCCGGCGG + Intergenic
929775700 2:44929450-44929472 GGGCGGGGGCGCGGAGGTTTGGG + Intergenic
929778829 2:44944497-44944519 GAGCGGCGGCGCGGGGGAGCCGG + Intronic
930872771 2:56184692-56184714 GGGCGGGGCCGCGGACGAGCCGG - Exonic
931253744 2:60553773-60553795 GTGCGGGGAGGGGGAGGTGCGGG + Intergenic
931321348 2:61177324-61177346 GCGCGGGGACGCGGGGACGCGGG - Intergenic
931463410 2:62467201-62467223 GTGCAGGGGTGGGGAGGCGTGGG - Intergenic
932345869 2:70994839-70994861 GGGCGGGGACGCGGCGGCGGCGG - Exonic
933752437 2:85611703-85611725 TTGCGGGGCCGCGTCGGCGCGGG + Exonic
934566978 2:95346603-95346625 GCGCGGGGGCGCGGCGGCGGCGG - Intronic
935059152 2:99593151-99593173 GTGCGGGGGCGTGGAGGGGAAGG - Intronic
936569839 2:113603745-113603767 GCGCAGGCGCGCCGAGGCGCAGG + Intergenic
936569845 2:113603777-113603799 GCGCAGGCGCGCCGAGGCGCAGG + Intergenic
937221734 2:120346046-120346068 GGGCGGGCGGGCGGAGGCCCGGG + Intergenic
938338978 2:130522998-130523020 GCGCGCGGGTGCGGGGGCGCGGG + Intronic
938350860 2:130597752-130597774 GCGCGCGGGTGCGGGGGCGCGGG - Intronic
938392411 2:130916238-130916260 AGGCGGGGACGCGGGGGCGCTGG - Intronic
939914297 2:148020893-148020915 GAGCGGGGGCGGGGAGGAGGAGG - Intronic
940145759 2:150542643-150542665 GCGGGGGGGCGGGGAGGGGCGGG + Intergenic
941021039 2:160407967-160407989 GCGGGCGGGCGGGGAGGCGCGGG - Intronic
942043348 2:172085169-172085191 GGGCGGCGGCGCGGAGCCGCTGG + Intronic
942045861 2:172099126-172099148 GGGCGCGGGGGCGGTGGCGCCGG + Intergenic
942314199 2:174682939-174682961 CGGCGGGGGGGCGGCGGCGCCGG - Intergenic
942344705 2:174990317-174990339 GTGGGGGGGTGCGGGGGGGCGGG + Intronic
942516968 2:176764341-176764363 GTGGGGGGTCGGGGGGGCGCTGG + Intergenic
944114477 2:196171777-196171799 GCGCGGCGGCGTGGCGGCGCAGG + Intronic
944451682 2:199850673-199850695 GTGGGGAGGCGCGGGGGCGGGGG - Intronic
945080869 2:206085510-206085532 GAGGGGGCGCGCGGAGGCCCGGG + Intronic
945225789 2:207530185-207530207 GAGGGGGGACGGGGAGGCGCCGG + Intronic
946311200 2:218883537-218883559 GCGCGGGGGCGGGGCGGGGCGGG - Intronic
946908991 2:224442386-224442408 GTGGAGGGGCGCGGTGGGGCGGG - Intergenic
947860493 2:233354471-233354493 GGGCGGGGGCGGGGCGGGGCCGG - Intergenic
948075647 2:235163380-235163402 GGGAGGGGGCGTGGAGGCACAGG + Intergenic
948609640 2:239158711-239158733 GGGCGGGTGCGCGGTGGGGCGGG - Intronic
948645181 2:239400329-239400351 GGGCGGGGGCGGGCGGGCGCCGG - Intronic
948645579 2:239401666-239401688 CTGCGTGCGCACGGAGGCGCAGG + Intronic
948893092 2:240916468-240916490 GCGCGGGGGCGCGGGGGCACGGG - Intergenic
948910068 2:240998497-240998519 GTGGGAGGGCGCGGGCGCGCGGG - Intergenic
948945672 2:241217919-241217941 GGGCGGGGGCGCGCAGGGGCGGG + Intronic
948945690 2:241217953-241217975 CAGCGGGGGCGCGCAGGGGCGGG + Intronic
948945704 2:241217983-241218005 CAGCGGGGGCGCGCAGGGGCGGG + Intronic
948945749 2:241218072-241218094 CAGCGGGGGCGCGCAGGGGCGGG + Intronic
948945774 2:241218126-241218148 GAGCGGGGGCGCGCAGGGGCGGG + Intronic
948972678 2:241441519-241441541 GTGCGGGGGGCCCGAGGGGCTGG - Exonic
949004332 2:241636908-241636930 GGGCGGGGGCGTGGCGGCCCGGG + Intronic
949040079 2:241844033-241844055 GGTCGGGGGCGCGGGGGCGCGGG + Intergenic
949040083 2:241844041-241844063 GCGCGGGGGCGCGGGGGCGCGGG + Intergenic
949040087 2:241844049-241844071 GCGCGGGGGCGCGGGGGCGCGGG + Intergenic
949046120 2:241873428-241873450 GGGCGGGGTCTCGGAGGCGGGGG - Exonic
949046195 2:241873641-241873663 GGGCGGGGTCTCGGAGGCGGGGG - Exonic
949079860 2:242088451-242088473 GGGCGGGGGCGGGGGGGCGCAGG - Intergenic
949079863 2:242088459-242088481 GCGCGGGGGGGCGGGGGCGGGGG - Intergenic
949079869 2:242088467-242088489 GCGCGGGGGCGCGGGGGGGCGGG - Intergenic
949079875 2:242088475-242088497 GCGCGGGGGCGCGGGGGCGCGGG - Intergenic
949079879 2:242088483-242088505 GCGCGGGGGCGCGGGGGCGCGGG - Intergenic
949079883 2:242088491-242088513 GTGTGGGGGCGCGGGGGCGCGGG - Intergenic
1168965097 20:1894262-1894284 GAGTCGGGGCGCGGGGGCGCGGG - Exonic
1169088169 20:2840177-2840199 GAGCGGGTGCGCGCATGCGCGGG - Intronic
1169130565 20:3164545-3164567 CTGCGGGAGCGCGGGGCCGCAGG - Exonic
1170015352 20:11775365-11775387 GTGCAGGGGCGGGGGGGCGGGGG - Intergenic
1171217283 20:23361792-23361814 CTGCTGGGGCCCGGAAGCGCTGG + Intergenic
1172037332 20:32019218-32019240 GAGCGGCGGCACGGAGGCGGCGG + Exonic
1172529310 20:35619118-35619140 GCGCGGGGGCGCGGGGGCTGGGG - Intronic
1172529315 20:35619126-35619148 GAGTCGGGGCGCGGGGGCGCGGG - Intronic
1172974154 20:38894103-38894125 GTGCGGGGGTGCGGGGGGGACGG - Intronic
1172974159 20:38894111-38894133 GGGCGGGGGTGCGGGGGTGCGGG - Intronic
1173454011 20:43189533-43189555 GTGTGGGCTCGCGGGGGCGCGGG - Intronic
1174357667 20:50009466-50009488 GTGCAGGGGCGGGGGGGGGCGGG - Intergenic
1174386656 20:50191494-50191516 GTGCAGGGGCGCGAAGCAGCCGG - Exonic
1175562044 20:59939257-59939279 AGGCGGTGGCGCGGTGGCGCGGG - Exonic
1175715500 20:61252393-61252415 GCGCGGGGGAGCGGCGGCGGCGG + Intergenic
1175873829 20:62220347-62220369 GGGCGGGGGCGGGGAGGGGGCGG - Intergenic
1176042228 20:63071962-63071984 GGGCGGGGGCGGGGAGGAGCGGG - Intergenic
1176148042 20:63574135-63574157 GGGCGGGGGCGCGGGGGTCCAGG - Intronic
1176148045 20:63574143-63574165 GGGCGGAGGGGCGGGGGCGCGGG - Intronic
1176274417 20:64255709-64255731 GTGCGCAGGCGCAGAGGCGGCGG + Intronic
1176567882 21:8396419-8396441 GGGCGGGCGCGCGTACGCGCGGG - Intergenic
1176575786 21:8440638-8440660 GGGCGGGCGCGCGTACGCGCGGG - Intergenic
1178417090 21:32412738-32412760 GCGGGGGGCCGCGGAGCCGCTGG + Exonic
1178417110 21:32412823-32412845 GCGCGGCGGGGCGGAGGCGCAGG - Exonic
1178427909 21:32493574-32493596 GTGCGTGGGAGCAGAGGGGCTGG - Intronic
1178488577 21:33033756-33033778 GTGCGGGGTCGGGGAAGCGAGGG - Intergenic
1178544037 21:33479012-33479034 GTCGGGGGGTGCGGAGGGGCAGG - Intronic
1179874689 21:44261950-44261972 CCGCGGGGGCGGGGAGGGGCGGG + Exonic
1180005571 21:45018999-45019021 GGGCGGGGGCCCGGAGGGGCGGG + Intergenic
1180014763 21:45074803-45074825 GCGCGGGGCCGCGGCGGCTCGGG + Intronic
1180843596 22:18970349-18970371 GGGCGGGGGCTGGGGGGCGCGGG - Intergenic
1180843610 22:18970375-18970397 GGGCGGGGGCTGGGGGGCGCGGG - Intergenic
1181094324 22:20495534-20495556 GGGCGCGGGCGCGTAGGGGCCGG - Intronic
1181162041 22:20965137-20965159 GCGGGGGGGCGGGGAGGCGCGGG - Exonic
1181175462 22:21032429-21032451 GGACGGGGGCGCGGCGGAGCAGG - Intronic
1181639660 22:24189959-24189981 GTGCGGGGAGGCGGAGGGGTGGG - Intergenic
1181967978 22:26669820-26669842 GTGCAGGGAGGCGGAGGCCCTGG + Intergenic
1182551853 22:31104947-31104969 GTCCGGGGGCGCGGCGGAGCTGG - Exonic
1182804393 22:33058136-33058158 ATGCGGGCGCACGGAGGGGCAGG - Intronic
1183192254 22:36329146-36329168 GGGTGGGGGCGCAGAGGGGCTGG + Intronic
1183321206 22:37166255-37166277 GTGGGGGGGCGGGGAGGCTCTGG - Intronic
1183444491 22:37844157-37844179 GGGCGAGTGCGCGGTGGCGCCGG - Exonic
1183535623 22:38398929-38398951 GCGCGGGGGCGGGGTGGGGCGGG - Intergenic
1183903347 22:41022188-41022210 GCGCGGGGCGGCGGAGGCGCGGG + Intergenic
1184523111 22:45007441-45007463 GGGCGGGGGCGCGCGGGGGCGGG + Intronic
1185272488 22:49935598-49935620 GTGGGGGCGCGGGGAGGAGCAGG + Intergenic
1185296720 22:50058322-50058344 GGCGGGGGGCGCGGGGGCGCGGG + Intergenic
1185343036 22:50300015-50300037 GGGCGGCGCCGAGGAGGCGCGGG - Intronic
1185384742 22:50526539-50526561 GTGTAGGGGAGCGGAGGCGGCGG - Intronic
1185389207 22:50549735-50549757 GGGCGGGGGCGGGCAGGGGCAGG - Exonic
1185413484 22:50697725-50697747 GCGGGGGGGCGCGGGGGGGCGGG + Intergenic
949993740 3:9600672-9600694 GGGCCGGGGGGCGGGGGCGCTGG + Intergenic
949993744 3:9600680-9600702 GGGCGGGGGCGCTGGGGCGCTGG + Intergenic
950125028 3:10505609-10505631 GGGGCGGGGGGCGGAGGCGCCGG + Intronic
950404691 3:12797160-12797182 GGGCGGGGGGGAGGGGGCGCTGG - Intronic
951558817 3:23945877-23945899 GTTCGGCGGCGCGCGGGCGCCGG + Intronic
952929293 3:38347052-38347074 GGGCAGGGGCGCGGGGGCCCCGG - Intronic
953925362 3:46979918-46979940 GTGCGGGCGCGGGGCGGGGCGGG - Intronic
954112225 3:48440461-48440483 GAGGGCGGGCGCGGAGGCACTGG + Intronic
954367537 3:50154615-50154637 GTGCGTGGGCCCCGCGGCGCAGG - Intergenic
954615609 3:51967525-51967547 GGGAGGGGGCGGGGAGGGGCCGG - Intronic
955818801 3:62874869-62874891 GGGCTGGGGGGCGGCGGCGCCGG - Exonic
956605008 3:71065080-71065102 GGGCCGGGGCGCGCGGGCGCGGG - Intronic
956813659 3:72888447-72888469 GCTCGGGGGCGCGGACGCGGGGG - Exonic
958779406 3:98522960-98522982 GTGGGGGCGGGCGGAGGCGCGGG - Intronic
960955126 3:123026450-123026472 GGGCGGGGGCGGGGAGGAGGGGG + Intronic
961164138 3:124751885-124751907 GTGGCGGGGCGGGGGGGCGCGGG - Intergenic
961545461 3:127629751-127629773 GGGCGGGTACGCTGAGGCGCGGG + Intronic
961665798 3:128492598-128492620 GTTCGGGGGCCGGGAGGCGGGGG + Intronic
961817177 3:129557060-129557082 GTGCGGTGGCTCGGCGGCGGGGG - Intronic
961868899 3:129974530-129974552 GAGCCGGGGCGCGGAGGCACTGG - Exonic
963107661 3:141660398-141660420 GTGCGGGCGCCCGGCGGGGCGGG + Intergenic
963827517 3:149970952-149970974 GGGCGGGGGCGGGGAGGAGGCGG + Exonic
964974244 3:162600080-162600102 GTGTGGGTGCACGGCGGCGCGGG + Intergenic
966592187 3:181695591-181695613 GAGTGGGGAAGCGGAGGCGCGGG - Intergenic
966866137 3:184260061-184260083 GGGCCGGGGCGGGGGGGCGCCGG + Exonic
967493622 3:190120335-190120357 ATGCGGGGCCCCCGAGGCGCTGG + Exonic
968010531 3:195271198-195271220 GCGCCGGTGCGCGGAGGGGCGGG + Intergenic
968186053 3:196634259-196634281 GTGCGGGGGTGGGGTGGGGCTGG - Intergenic
968213333 3:196867781-196867803 GGGCGGGGGCGGGGCGGCCCCGG + Intergenic
968434127 4:576251-576273 GCGCGGGGTCGCGGCGGCGGCGG - Intergenic
968514983 4:1012017-1012039 GGGCGGGGGCGGGGAGGGGCGGG + Intronic
968518348 4:1024135-1024157 GTGCTGGTGGGCGGGGGCGCTGG + Intronic
968518362 4:1024167-1024189 GTGCTGGTGGGCGGGGGCGCTGG + Intronic
968556556 4:1248861-1248883 GGGCGGGGGCGGGGCGGGGCGGG - Intronic
968579101 4:1381464-1381486 GTGCGGGTGCCCAGAGGCCCTGG + Intronic
968850306 4:3074061-3074083 GGGGTGGGGCGCGGAGGGGCAGG - Intergenic
969285698 4:6200659-6200681 GGGCGGGGGCGGGGCGGGGCGGG - Intergenic
970399406 4:15703230-15703252 GGGCGCGCGCGCGGTGGCGCGGG + Exonic
971244101 4:24912973-24912995 GCGCAGCGGCTCGGAGGCGCCGG - Intronic
971244335 4:24914563-24914585 GTGGGGGGGCGTGGAGGGGGCGG - Intronic
971457369 4:26857687-26857709 GCGCGGGGCTGCGGTGGCGCAGG + Intronic
972686854 4:41360597-41360619 GGGAGCGAGCGCGGAGGCGCCGG - Intronic
972738154 4:41865498-41865520 GTGCGGTGGCGCAAAGGCCCGGG - Intergenic
972766852 4:42159183-42159205 GGGCGGGGGCAGGGAGGGGCAGG - Intergenic
973613688 4:52659325-52659347 GGGAGGGAGCGCGGAGGGGCGGG + Exonic
973774798 4:54233177-54233199 GCGCAGGGGCGCAGGGGCGCAGG + Intronic
975661073 4:76689531-76689553 GCGCGGTGGCGCGGTGGCGCAGG + Intronic
976235343 4:82890984-82891006 GTGCGGGGCAGCGGAGACCCAGG + Intronic
977064988 4:92303945-92303967 TTGCTGGGGCGCGGTGGCGGGGG - Intronic
977206554 4:94170114-94170136 GGGCGGGGGTGGGGAGGCTCAGG - Intergenic
977908278 4:102501633-102501655 GAGCGGGAGCGCGGCGGGGCCGG - Exonic
978073138 4:104495069-104495091 GGGCGGGGGCGCGGGGGTGGGGG + Intergenic
979231470 4:118352823-118352845 GTGCGGGGGCGGGAGGGGGCTGG - Exonic
979349264 4:119627300-119627322 GGGCGGCGGCGCGGAGGCCGGGG - Intronic
979674815 4:123398796-123398818 GAGCGGCGGCGCGGTGGCCCAGG + Intronic
980595851 4:134953024-134953046 GGGCGGGGGCGCGTAGGCTCTGG - Intergenic
983649779 4:170026466-170026488 GCCGGGCGGCGCGGAGGCGCGGG + Intronic
985588161 5:751421-751443 GTGTGGGGGCGGGGAGGCAGGGG + Intronic
985602831 5:843884-843906 GTGTGGGGGCGGGGAGGCAGGGG + Intronic
985708349 5:1414397-1414419 GTGGGGGGGCCTGGAGGGGCAGG + Intronic
985784875 5:1888161-1888183 CTGCGGGGGCGAGGTGGCGGGGG - Intergenic
987335673 5:16895919-16895941 GGGCGGGGGCAGGGAGGAGCAGG + Intronic
989103434 5:37840078-37840100 GGGTGGGGGAGGGGAGGCGCGGG + Intergenic
990040980 5:51378616-51378638 GAGCGGGGGAGGGGAGGCGAAGG - Intergenic
990557599 5:56951736-56951758 GGGAAGAGGCGCGGAGGCGCCGG + Intronic
990955061 5:61332440-61332462 GTGCGGGGGCGGCGCGGCGCTGG + Exonic
991427150 5:66503619-66503641 GTGTGGGCGCACGGCGGCGCGGG + Intergenic
992067403 5:73120508-73120530 CTGCGCGGGCGCGGCGGCCCGGG - Exonic
992067478 5:73120778-73120800 CCGCGGCAGCGCGGAGGCGCTGG + Intronic
992081073 5:73234482-73234504 GTGAAGGGGCGGGGAGGGGCGGG - Intergenic
992939561 5:81750226-81750248 GGGCGGGGGCGGGTGGGCGCCGG - Intronic
995342299 5:111073208-111073230 GAGCCCGAGCGCGGAGGCGCCGG - Intronic
995735603 5:115296715-115296737 GTGCAGGGGTGCGGGGGTGCGGG + Exonic
995735678 5:115296885-115296907 GTGTGGGGGCGGGGCGGGGCGGG + Intergenic
998130288 5:139648334-139648356 GGGCGGGCGCGCGGCGGCGGCGG + Exonic
998353003 5:141513330-141513352 GGGCGGGGGCGGGTTGGCGCCGG + Intergenic
1001240730 5:170067897-170067919 GTGCTGGGGCAGGGAGGGGCAGG + Intronic
1001495975 5:172188043-172188065 GGCCGGGGGCGCGGTGGCGCCGG + Exonic
1001773418 5:174312027-174312049 GCGCGGGGGCGCGGGGGCTCGGG + Intergenic
1002093403 5:176817569-176817591 GGGCGGGGGTGGGGAGGGGCGGG - Intronic
1002209908 5:177592399-177592421 GTGCGGGGGCGGGGAGGAAGGGG + Intronic
1002541153 5:179907503-179907525 GGGCCGGGGCGGGGAGGCGAGGG - Intronic
1002844705 6:936274-936296 GTGCGGGGGCCGGGAGGGGCTGG - Intergenic
1002897694 6:1389174-1389196 GGAAGGGGGCGCGGAGGGGCGGG + Intergenic
1002991741 6:2245294-2245316 GTGCGGGGGCGGGGGCGCGCCGG - Intronic
1003112128 6:3259222-3259244 GGGCGGCGGGGCGGGGGCGCGGG + Intronic
1003112131 6:3259230-3259252 GGGCGGGGGCGCGGGGGCGCCGG + Intronic
1003942671 6:11044371-11044393 CCGAGGGGGCGGGGAGGCGCGGG - Intergenic
1004193999 6:13487769-13487791 GGGCGGGGCCGGGGAGGAGCCGG - Intergenic
1004864119 6:19837241-19837263 GGGCGGGGGCGCGGAGGGAGAGG - Intergenic
1004924001 6:20402101-20402123 GAGAGGGGGCTCGGAAGCGCCGG + Intronic
1005959887 6:30687132-30687154 GGGAGGGGGTGCGGAGGAGCCGG + Exonic
1006133715 6:31883437-31883459 GTGCTGGGGCGAGGAGGCAGAGG + Exonic
1006170127 6:32087627-32087649 GGGCGGGGGTGCGGGGGAGCCGG + Intronic
1006334012 6:33411105-33411127 GTGGGGGGGCGTGCAGGCGGAGG - Exonic
1007478310 6:42133820-42133842 GGGCGGGGGCGGGGCGGGGCGGG + Intronic
1007479026 6:42137813-42137835 GGGCGGGGGCGGGGCGGGGCGGG + Intronic
1007669502 6:43539660-43539682 GTGGGGGGGCCTGGAGGCCCTGG - Intronic
1007739567 6:44002481-44002503 CTGCGGGGGCGGGGAGGAGTCGG - Intronic
1010703455 6:79078342-79078364 GCGCCGGGGGGCGGGGGCGCGGG - Intergenic
1011448958 6:87472949-87472971 GCGCGGGGGCGCGGAGGGGGCGG + Intronic
1011983951 6:93419107-93419129 GTGAGGGGGCGGGGAGCCGGCGG + Intronic
1012410120 6:98947627-98947649 AAGCGGAGGCGCGGGGGCGCGGG + Intronic
1012410123 6:98947635-98947657 GCGCGGGGGCGCGGGGCCGCGGG + Intronic
1012639228 6:101588376-101588398 GTGCAGGGGCGGGGAGGATCAGG + Intronic
1012986351 6:105880414-105880436 GTGCGGGGGCGCGTGTGCTCCGG - Intergenic
1013576053 6:111483838-111483860 GGGTGGGGGCGCGCGGGCGCGGG + Intergenic
1014137592 6:117907393-117907415 GCGCGGGGGCGCGGAGCTGCCGG - Intergenic
1014536439 6:122619484-122619506 GTGCGGGGGTGAGAAGGCACAGG - Intronic
1015149066 6:130019204-130019226 GTGGGGGAGCGCGGCGGCGCCGG + Intronic
1015776819 6:136822818-136822840 GGGCCGGGGGGCGGAGGCGGAGG + Intronic
1016328223 6:142927001-142927023 GCGCGGCGGCGCGGCGGCGCGGG + Intronic
1016982323 6:149864397-149864419 GCGCGGGGGCGGGGCCGCGCGGG - Intergenic
1018727838 6:166627312-166627334 GTGCCGGGGCGCGGAGCGGCGGG - Intronic
1018786998 6:167116307-167116329 GAGCGAGGGCGGGGAGGCCCCGG - Intergenic
1019142210 6:169956061-169956083 GTGAGGGGGCGTGGAGGGGAGGG + Intergenic
1019473398 7:1232970-1232992 GTGGCGGGGCGCGGGGGCGCGGG - Exonic
1019520782 7:1459692-1459714 GTGCCGGGGCCAGGAGGCGTGGG - Intergenic
1019731505 7:2631919-2631941 GGGCGGGGGTGCGGAGGGGGCGG + Intergenic
1021719247 7:23490434-23490456 GGGCGGGGGCGGGCGGGCGCGGG + Intergenic
1021958799 7:25852581-25852603 GGGCGGGGGCGCGGAGGACGCGG - Intergenic
1023287105 7:38631398-38631420 TGGCGGCGGCGCGGAGGAGCGGG + Exonic
1023881981 7:44325850-44325872 GTGCGGGGGCGGGCGGGGGCGGG - Intronic
1023937264 7:44748863-44748885 GGGCGGCGGCGCGATGGCGCGGG + Intronic
1023955766 7:44885488-44885510 GGGGCGGGGCGCGGAGGCGATGG - Intergenic
1024307738 7:47942436-47942458 GAGTGGGGGGGCGGGGGCGCGGG - Intronic
1024700609 7:51900984-51901006 GTGGGTGGGGGCGGAGGCTCAGG + Intergenic
1026894138 7:74000292-74000314 GTGGGGGGGGGCGGGGGCGGGGG + Intergenic
1027653201 7:80897006-80897028 GTGTGGGGGCAGGTAGGCGCCGG + Intronic
1028621582 7:92834003-92834025 GCGCGGGGGAGGGGAGGCGCCGG + Intronic
1029238701 7:99143682-99143704 GCGAGGGGGCGCCGGGGCGCGGG + Intronic
1029238728 7:99143810-99143832 GGGCTGGGGGGCGGTGGCGCTGG - Exonic
1029238828 7:99144142-99144164 GCGCGGGGGCGCGCAGGGCCGGG - Intergenic
1029372420 7:100158207-100158229 ATGCCGGGGGGCGGCGGCGCCGG - Exonic
1029413704 7:100430397-100430419 TTGCGGGGTCGAGGAGGAGCAGG - Exonic
1029496046 7:100895891-100895913 GTGCGGGGGGCCGGAGGCGGCGG - Exonic
1029496326 7:100896993-100897015 GTGCGCGCGCGCGGCGGTGCGGG + Intergenic
1029536286 7:101159724-101159746 GGGCGGGGGCGCTGGGGAGCAGG - Intronic
1029708333 7:102286817-102286839 GGGCGGGGGCGGGGCGGGGCCGG + Intronic
1029738651 7:102479078-102479100 GTGCGGGGTGGCGGGGGCGGGGG - Intergenic
1029746432 7:102517814-102517836 GGGCGGGGGCGGGGCGGCGGGGG + Intergenic
1029764369 7:102616793-102616815 GGGCGGGGGCGGGGCGGCGGGGG + Intronic
1030733556 7:113017724-113017746 GTGCGGGGGCACGGTGGCGCGGG + Intergenic
1031043550 7:116862919-116862941 GGGCGGGGGCGCGGGCGCGGGGG + Intronic
1031986554 7:128167722-128167744 GCGCGGGGGCGCGGGAGCCCCGG + Intergenic
1032167640 7:129558259-129558281 GGGTGGGGGCGGGGAGGCGGGGG - Intergenic
1033220373 7:139523591-139523613 GGGAGGAGGCGCGGAGGAGCGGG - Intergenic
1033654384 7:143362862-143362884 GAGCAGGGGCGGGGAGGCGCGGG - Intergenic
1034418723 7:150978182-150978204 GCGCGGGGACGCGGCGGAGCGGG - Exonic
1034617933 7:152435529-152435551 GCGCCGGGGCGCGGAGGCCGCGG + Intronic
1034659902 7:152759950-152759972 GAGCGGGGCCGCGGAGGAGCGGG - Intronic
1034911705 7:155003078-155003100 GGGCGGGGGCGCGGAGGGCGGGG - Exonic
1034963112 7:155374427-155374449 GCGCGTGTGGGCGGAGGCGCCGG + Intergenic
1035248364 7:157580563-157580585 GTGCAGGGGCTCGGATGTGCAGG - Intronic
1035436508 7:158863776-158863798 GTGTGGGGGCGGGGGGGAGCGGG + Intronic
1035602066 8:902741-902763 GTGCGGGTGGGCGGGGGCGGGGG + Intergenic
1035602089 8:902809-902831 GTGCGGGTGGGCGGGGCCGCCGG + Intergenic
1035602128 8:902906-902928 GTGCGGGTGGGCGGGGGCGGTGG + Intergenic
1035650074 8:1257424-1257446 GGGCGGGGGGGTGGAGGGGCAGG - Intergenic
1035764848 8:2097946-2097968 GTGCCGGGTCGGGGAGGCGCTGG - Intronic
1036242575 8:7092351-7092373 TGCCGGGGGCGCGGAGGTGCCGG + Intergenic
1036786685 8:11692665-11692687 GTGCGGGGGTGCGGGGGTGAGGG + Intronic
1036899244 8:12659086-12659108 GTCCGGGGGCGCGGAGGTGCCGG - Intergenic
1038185674 8:25272636-25272658 GAGTGGGGTTGCGGAGGCGCTGG - Intronic
1038205055 8:25458165-25458187 GTGAGGGGGCGCGGCGGGCCGGG - Intronic
1038540502 8:28386333-28386355 GTGCGGGGGCGCGGAGGCGCGGG - Intronic
1038760925 8:30384196-30384218 GTCCCGGGGCGCGCAGACGCCGG + Intergenic
1039212694 8:35235348-35235370 GGGCGGTGACGCGGCGGCGCTGG - Intergenic
1040038842 8:42896768-42896790 CGGCGGCGGCGCGGCGGCGCGGG + Intronic
1040545785 8:48396976-48396998 GGGCGGGGGCGGGGGTGCGCGGG - Intergenic
1040954889 8:52969932-52969954 GTGGAGGGGAGCGGAGGCTCAGG + Intergenic
1041044478 8:53878065-53878087 GTGCTGGGGTGGTGAGGCGCGGG - Intronic
1041686944 8:60652612-60652634 AGCCGGGGGCGGGGAGGCGCCGG + Intergenic
1042336008 8:67630790-67630812 GTGCGGGGCCGCGGAGCCTGCGG - Intronic
1042591824 8:70403869-70403891 GTGCGGAGACGCGGAGGAGGAGG - Intergenic
1044707844 8:95025351-95025373 GTGCGGGTGTGCGGAGGCAGCGG + Intronic
1045663970 8:104466631-104466653 GGGCGGGGGCGCGGCGGGGCGGG + Intronic
1045737939 8:105318538-105318560 GAGGGGGAGCGCGGGGGCGCAGG - Intronic
1047041796 8:121005256-121005278 GTGCGGGGGTGCTGGGGTGCTGG + Intergenic
1047998628 8:130358744-130358766 GAGCGGGGGCGGGGCGGGGCGGG - Intronic
1049194539 8:141308156-141308178 CTACGGGGGCGCGGAGCCCCGGG + Intronic
1049419607 8:142510934-142510956 CTGCGGGGGGGCGGAGGAGGAGG - Exonic
1049585408 8:143430506-143430528 CGGCGGGGGCGGGGGGGCGCCGG + Intergenic
1049585410 8:143430512-143430534 GGGCGGGGGGGCGCCGGCGCGGG + Intergenic
1049693684 8:143973573-143973595 GTGCGGGGGCGGGGCGGGGGCGG - Intronic
1049756602 8:144313733-144313755 GCGGGGAGGCGGGGAGGCGCGGG - Intronic
1049784581 8:144444344-144444366 CTCCGGGGGCGCGGAGGCTGGGG - Intronic
1049796839 8:144500846-144500868 GTGCGGGGACGAGGAGGTGCGGG + Exonic
1049803969 8:144530630-144530652 GAGGGTGGGCGCGGAGGGGCGGG + Intronic
1050744131 9:8857701-8857723 GTGGCGGGGCGCGAAGGCGCTGG - Intronic
1051482972 9:17579192-17579214 GTGCGGGAGGGAGGAGGCGGAGG - Exonic
1053003368 9:34589871-34589893 GCGCGCGGCCGCGGAGGCGCGGG - Intronic
1055908171 9:81317456-81317478 GTGCAGGGGCCCTGAGGCACAGG - Intergenic
1057146937 9:92764847-92764869 GTGCGGCGGCGCGGGCGGGCGGG - Intergenic
1057432163 9:95004731-95004753 GCGCGGGGGCGCGGGGCGGCCGG + Intronic
1057432187 9:95004783-95004805 GCGCGGGGGCGCGGGGCGGCCGG + Intronic
1057488542 9:95505855-95505877 GCGCGGGGCTGCGGAGGCGGCGG - Intronic
1057546223 9:96021773-96021795 GGGCGGGAGGGCGGAGGCGCCGG + Intergenic
1058023710 9:100117590-100117612 GGGCGGGGGGCCGGAGGCCCTGG - Intronic
1058176073 9:101737872-101737894 CTGCGGGTGCGAGGAGGAGCTGG + Exonic
1059119726 9:111631289-111631311 GTGCGCCTGCGCGGAGGCGTCGG + Intergenic
1059375256 9:113876230-113876252 GGCCGGGGGGGCGGGGGCGCTGG - Intergenic
1060514576 9:124257917-124257939 GGGCGGGCGCGCGGGCGCGCGGG + Intronic
1061028941 9:128068203-128068225 GAGCGCGGGCTCGGAGACGCCGG - Exonic
1061052158 9:128203355-128203377 GGGCGGGGGCCCCGCGGCGCAGG + Intronic
1061317109 9:129803230-129803252 GCTCCGGGGCGCGGCGGCGCTGG + Exonic
1061347980 9:130042574-130042596 GCGTGGGGGCGTGGAGGCCCCGG - Intronic
1061587220 9:131576963-131576985 GTGGGGGGGCAAGGAGGGGCAGG - Exonic
1061839176 9:133347838-133347860 GTGGGTGGGTGCGTAGGCGCTGG - Intronic
1062022578 9:134326391-134326413 GCGCGGGCGCGCGGCGGCGGGGG + Intronic
1062360332 9:136185244-136185266 GTGCAGGGGTGAGGAGGGGCCGG - Intergenic
1062392305 9:136338711-136338733 GTGCGTGGGCGCGGACGCGGCGG + Intronic
1062533616 9:137012199-137012221 GGGCCGGGGCGGGGAGGAGCTGG - Intronic
1062544101 9:137054040-137054062 GTGCGGGGAGCCGGAGGCGGAGG + Exonic
1062567313 9:137168955-137168977 GGGCGGCGGTGCGGAGGCGGCGG + Exonic
1203470237 Un_GL000220v1:112840-112862 GGGCGGGCGCGCGTACGCGCGGG - Intergenic
1203478058 Un_GL000220v1:156812-156834 GGGCGGGCGCGCGTACGCGCGGG - Intergenic
1185700985 X:2229761-2229783 GTGTGGGGGCGCAGATGTGCGGG + Intronic
1185747607 X:2584615-2584637 GGCGGGGGGCGCGGGGGCGCGGG + Intergenic
1187648322 X:21374137-21374159 GTGCGCGGCGGCGGAGGCGGTGG - Intergenic
1187648324 X:21374143-21374165 GTGCGCGTGCGCGGCGGCGGAGG - Intergenic
1187915430 X:24149412-24149434 GGGCGGGAGCGCGGAGGAGGTGG + Intronic
1188525902 X:31087686-31087708 GTGCGGGGTGGCGGGGGTGCAGG - Intergenic
1190302275 X:49063943-49063965 GTGCGGTGGAGGGTAGGCGCGGG - Exonic
1190789585 X:53686458-53686480 GCGCGGAGGCGCGGAGGTGGCGG - Intronic
1198517559 X:137425030-137425052 GGGCGGGGGCCCGGGGGCGGGGG + Intergenic
1199445103 X:147912040-147912062 GTGCGGCAGCGCGGCGGCGGCGG + Exonic
1199771141 X:150976081-150976103 GAGCAGGGACGCGGTGGCGCTGG + Intergenic
1200074386 X:153543940-153543962 GTGTGGGGGCGTGGGGGCGTGGG + Intronic
1200109965 X:153736067-153736089 GTGGCGGGGCGGGGAGGGGCAGG - Intronic
1200118990 X:153781624-153781646 GTGCTGGGCCCCGGAGGCGAAGG - Intronic
1200235878 X:154467481-154467503 GGGTGGGGGCGGGGAGGGGCGGG + Intronic