ID: 1038543085

View in Genome Browser
Species Human (GRCh38)
Location 8:28405036-28405058
Sequence CGGTTCCTCATTTGTAAACC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1038543080_1038543085 24 Left 1038543080 8:28404989-28405011 CCGCCTACTTGCTCTCTCGGACA 0: 1
1: 0
2: 0
3: 6
4: 135
Right 1038543085 8:28405036-28405058 CGGTTCCTCATTTGTAAACCTGG No data
1038543081_1038543085 21 Left 1038543081 8:28404992-28405014 CCTACTTGCTCTCTCGGACAAGT 0: 1
1: 0
2: 0
3: 4
4: 71
Right 1038543085 8:28405036-28405058 CGGTTCCTCATTTGTAAACCTGG No data
1038543078_1038543085 27 Left 1038543078 8:28404986-28405008 CCTCCGCCTACTTGCTCTCTCGG 0: 1
1: 0
2: 1
3: 9
4: 108
Right 1038543085 8:28405036-28405058 CGGTTCCTCATTTGTAAACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1038543085 Original CRISPR CGGTTCCTCATTTGTAAACC TGG Intronic
No off target data available for this crispr