ID: 1038544044

View in Genome Browser
Species Human (GRCh38)
Location 8:28412086-28412108
Sequence TGCAGGCGGCGCGCAGGGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 234
Summary {0: 1, 1: 0, 2: 0, 3: 25, 4: 208}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1038544044_1038544066 26 Left 1038544044 8:28412086-28412108 CCCACCCCTGCGCGCCGCCTGCA 0: 1
1: 0
2: 0
3: 25
4: 208
Right 1038544066 8:28412135-28412157 CCTCCCAGGCCGCTCGCTGCAGG No data
1038544044_1038544059 12 Left 1038544044 8:28412086-28412108 CCCACCCCTGCGCGCCGCCTGCA 0: 1
1: 0
2: 0
3: 25
4: 208
Right 1038544059 8:28412121-28412143 CAGGGCGCCCCCCGCCTCCCAGG No data
1038544044_1038544055 -7 Left 1038544044 8:28412086-28412108 CCCACCCCTGCGCGCCGCCTGCA 0: 1
1: 0
2: 0
3: 25
4: 208
Right 1038544055 8:28412102-28412124 GCCTGCAGGGGAGACCGGGCAGG No data
1038544044_1038544057 -6 Left 1038544044 8:28412086-28412108 CCCACCCCTGCGCGCCGCCTGCA 0: 1
1: 0
2: 0
3: 25
4: 208
Right 1038544057 8:28412103-28412125 CCTGCAGGGGAGACCGGGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1038544044 Original CRISPR TGCAGGCGGCGCGCAGGGGT GGG (reversed) Intronic
901016708 1:6236020-6236042 GGCAGGCGGCGCGCAGCTGCGGG - Intergenic
901055574 1:6447384-6447406 TGCAGGGGGCGCGGAGCGGGCGG + Intronic
903233838 1:21937257-21937279 TGCGGGCGGCGCGGAGCGGGCGG - Exonic
904383892 1:30129412-30129434 TGGAGGAGGCGGGGAGGGGTTGG + Intergenic
905166873 1:36088198-36088220 TGCAGGAGGAGGGCAGGGTTGGG + Exonic
910657579 1:89633615-89633637 TGCAGACTGGGCGCGGGGGTGGG + Intronic
912361594 1:109100337-109100359 GGGAGGAGGGGCGCAGGGGTGGG - Intergenic
913098053 1:115538334-115538356 AGCAGGCAGAGAGCAGGGGTGGG - Intergenic
915323067 1:155066706-155066728 TGCAGGCATAACGCAGGGGTGGG - Intronic
920021182 1:202957968-202957990 CGGAGGCGGCGCGCAGTGGGAGG + Intronic
920847137 1:209603605-209603627 TGCAAGGGGCGAGGAGGGGTGGG - Intronic
920912558 1:210232572-210232594 GGCAGGGGGCGGGCTGGGGTGGG + Intergenic
921629153 1:217413000-217413022 GGCAGGCGGAGCCCAGGAGTTGG - Intergenic
922496607 1:226062528-226062550 AGCGGGCGGCGCGCGGGGGAGGG + Intronic
923140832 1:231160975-231160997 TGCAGCCTGCGCCCAGGGCTTGG - Intergenic
1063443033 10:6088997-6089019 CGCAGGCGGGGCGCAGGCGCGGG + Intronic
1064393271 10:14959596-14959618 TACGGCCGGGGCGCAGGGGTTGG - Intronic
1064868034 10:19904476-19904498 TGCTGGGGGTGGGCAGGGGTTGG - Intronic
1066406847 10:35126872-35126894 TGCTGGCGGCCGGCAGGGGGCGG + Intronic
1066464560 10:35640927-35640949 GGCAGGCGGCGCGGCGGGCTGGG + Exonic
1067427523 10:46221113-46221135 TGCAGGCAGCAGGCAGGAGTGGG + Intergenic
1067582953 10:47457048-47457070 TGCAGGCAGCAGGCAGGAGTGGG + Intergenic
1070390651 10:75967759-75967781 GGGAGGCGGCGGGCAGGGGTGGG + Intronic
1070942084 10:80356950-80356972 TGGAGGGGGCGTGCAGGAGTAGG + Intronic
1072562308 10:96587149-96587171 GGCAGCCGGCGCGCAGGCGGCGG - Intronic
1073533712 10:104255319-104255341 TGCAGGCGGCGGGGTGGGGTGGG + Intronic
1077097493 11:805185-805207 TGCAGGCGGCGCGCAAAGGGTGG + Exonic
1077423428 11:2463452-2463474 TGCAGGTGGCGGGCGGGGCTGGG + Intronic
1077432302 11:2521948-2521970 TGCAGGCAGCGGGCCTGGGTGGG - Intronic
1077492755 11:2869773-2869795 TGCAGGCCGCGAGCAGCGGCGGG + Intergenic
1083303724 11:61752465-61752487 TGCAGGCGGCGCTCAGCGCTGGG - Intergenic
1084606421 11:70175005-70175027 GGCAGGTGGCGGGCGGGGGTGGG - Intronic
1092057883 12:5522541-5522563 TGCAGCTGGCTCGCAGAGGTGGG + Intergenic
1096178650 12:49538999-49539021 TGCAGGCGGCGGGCGCGGGAGGG + Intergenic
1096509521 12:52119954-52119976 GGGAGGCGGCACTCAGGGGTGGG + Intergenic
1096514062 12:52146742-52146764 GGCAGGCAGCAGGCAGGGGTGGG - Intergenic
1098161098 12:67648838-67648860 GGCCCGCGGCGCGCAGGGGAGGG + Exonic
1099989605 12:89708715-89708737 CGCAGCCGGCTCGCAGGGCTCGG + Exonic
1100572795 12:95858798-95858820 TGCAGGCGGCGCGCGGACCTTGG - Intergenic
1101302483 12:103495918-103495940 TGCGGGCGGCGCCCCGGGATAGG - Exonic
1102471034 12:113160044-113160066 TGCAGTGGGCGTGCAGGGGCTGG - Intronic
1102566976 12:113803297-113803319 GGCGGGCGGCGGGCAGGTGTGGG - Intergenic
1104787155 12:131457148-131457170 TGCTGGCGGAGCCCAGGGCTGGG - Intergenic
1106569699 13:30915819-30915841 TGGAGGAGGGGCGCTGGGGTGGG - Intronic
1111911997 13:94323156-94323178 GGCAGGCTCCGCTCAGGGGTTGG - Intronic
1113800175 13:113082403-113082425 TGCAGGGAGAGCGCAGAGGTCGG - Intronic
1113910680 13:113839890-113839912 TGCGTTGGGCGCGCAGGGGTGGG - Intronic
1113957887 13:114108918-114108940 TGCATGCAGCGTGCAGGTGTCGG + Intronic
1113970506 13:114185251-114185273 TCCAGGGGGCTCCCAGGGGTGGG - Intergenic
1114514070 14:23286117-23286139 TGGAGGCGGGGCGGATGGGTGGG + Exonic
1115399417 14:32939806-32939828 GGAAGGCGGCGAGCAGGGGGAGG + Intronic
1117912510 14:60648868-60648890 TGCCCACGGCGCCCAGGGGTCGG + Exonic
1119562876 14:75605019-75605041 TGAAGGAAGCGGGCAGGGGTAGG + Intronic
1119693366 14:76694037-76694059 GGCAGGGGGCTGGCAGGGGTTGG + Intergenic
1122783753 14:104154640-104154662 TGCAGGCAGGGCACTGGGGTGGG - Intronic
1122905778 14:104800829-104800851 TGGAGGCGGCGCGGAGGCGTGGG + Intronic
1122960896 14:105093299-105093321 TCCGGGCGGCGCGCAGGCGCGGG - Intergenic
1125209449 15:37196481-37196503 TGCAGGAGGTGGGAAGGGGTGGG - Intergenic
1129220719 15:74130198-74130220 AGCAGGCGGGGCGGGGGGGTTGG + Intronic
1129722250 15:77883901-77883923 AGCAGGCAGCGGGCAGGAGTGGG - Intergenic
1132553770 16:564066-564088 TACAGGCGGGGGGCCGGGGTGGG - Exonic
1132778942 16:1612555-1612577 TGCAGCCGGCGCTCGGGGGCCGG + Intronic
1133188295 16:4115864-4115886 CGCAGGCGGCTCGCGGGGCTGGG - Exonic
1138589325 16:57991036-57991058 TCCAAGCTGCGGGCAGGGGTGGG + Intergenic
1139418153 16:66830996-66831018 TGCAGGCAGCGCGCAGGAGACGG - Intronic
1141524754 16:84604183-84604205 TGGATGGGGAGCGCAGGGGTTGG - Intronic
1141594140 16:85087188-85087210 GGCAGGAGGCGGGCAGGGCTGGG + Intronic
1141656792 16:85420934-85420956 TGCAGGGGGCGCGCTGCAGTCGG + Intergenic
1142196429 16:88741309-88741331 TGCAGGCTGGGCCCCGGGGTGGG + Intronic
1142215138 16:88826270-88826292 TGCAGGCAGGGAACAGGGGTGGG + Intronic
1143655392 17:8290800-8290822 TGCAGGCGGGAAGCAGGGGATGG - Intronic
1143898647 17:10156721-10156743 TGCAGGCTGCAGGCTGGGGTTGG + Intronic
1144206042 17:12980183-12980205 TGCAGGCGGCTGGCTGGGGCTGG - Exonic
1145041370 17:19580152-19580174 AGCGGCCGCCGCGCAGGGGTGGG + Intergenic
1147259041 17:39197860-39197882 TGCAGGCGGCCCGCTGGGGCGGG + Intergenic
1147319451 17:39637048-39637070 TGGAGGCGGGGCGAAGGGGCGGG + Exonic
1149362775 17:55911602-55911624 TGTAGGGGGTTCGCAGGGGTGGG + Intergenic
1150124903 17:62629234-62629256 GGCAGGCGGTGGGAAGGGGTGGG + Intronic
1153526338 18:5998318-5998340 TGCAGACGCAGCGCAGGGGAGGG - Intronic
1153981601 18:10315194-10315216 TGCAGGCAGGGCCCAGGAGTGGG - Intergenic
1154318006 18:13321200-13321222 TGCAGACGGCGGGTAGGGGCAGG - Intronic
1154354530 18:13614992-13615014 GGCAGGAGGCGTGCAGGGGAAGG + Intronic
1155053206 18:22165653-22165675 CGCCGGCGGCGCACGGGGGTCGG + Intergenic
1156678236 18:39557374-39557396 TGGAGGCGGAGCTCAGGGGGAGG + Intergenic
1159040601 18:63320103-63320125 GGCAGGCGGCGCGGAGGGGCGGG + Exonic
1160497721 18:79384928-79384950 TGCAGGCCGGGAGCAAGGGTGGG - Intergenic
1160724964 19:613828-613850 TGCACGTGGCGCGCAGGGGGGGG - Intronic
1161009602 19:1953926-1953948 TGCAGTCGGCGCGGTGAGGTTGG + Intronic
1161568983 19:5019709-5019731 TGCAGGTGGTGTGCAGGTGTGGG + Intronic
1161959610 19:7516359-7516381 GGCCGGCGGCGCGCAGGGCGGGG - Intronic
1162367215 19:10256840-10256862 TGGAGGGGGCGGGGAGGGGTGGG + Intronic
1162426859 19:10602391-10602413 TGGAGGAGGCGCGCGGGGGCTGG + Intergenic
1162591976 19:11597804-11597826 CGCAGGCGTCGCGCAGGGACGGG - Intronic
1162644034 19:12035644-12035666 TCCAGGCGGCGAGCTGAGGTTGG - Exonic
1162725563 19:12688159-12688181 TGCAGGAGGCGGGAAGAGGTGGG + Intronic
1162818182 19:13208508-13208530 TGCGGGCGGCGGGGAGGGGGCGG + Intronic
1165479499 19:36054294-36054316 GGCAGGCGGCGAGCGCGGGTGGG - Exonic
1166718932 19:44986584-44986606 TGCAGGCAGCTGGCAGGGCTGGG - Intronic
1167113214 19:47473950-47473972 TCCAGGCTGGGGGCAGGGGTTGG - Intergenic
1167258772 19:48446004-48446026 AGATGGCGGCGCGCAAGGGTCGG + Exonic
1167668446 19:50836387-50836409 TGCAGGGGGCGCCCAGGAGCAGG - Intronic
1167698898 19:51030799-51030821 TGCAGGCGGCGTCCCGGGGCAGG - Exonic
925386650 2:3466641-3466663 AGCAGGCGGCGTGCAGGAGATGG - Intronic
927125962 2:20012600-20012622 GGGAGGCGGCGCGCGGGGGCCGG + Exonic
927333599 2:21894594-21894616 TGGAGGAGGCATGCAGGGGTTGG - Intergenic
927956665 2:27211968-27211990 GGCAGGGGGCGGGCAGGGGGCGG - Intronic
929788621 2:45008789-45008811 TGCCCACGGCGCCCAGGGGTCGG + Exonic
930680822 2:54255459-54255481 TGCAGGTGGAGCGCAGGTTTGGG - Exonic
931215078 2:60234518-60234540 TGCAGGCGGTGACCAGGAGTTGG + Intergenic
932611407 2:73202839-73202861 GGCCGCCGGCGCGCAGGGGTCGG - Exonic
935849797 2:107206102-107206124 TGCAGGCTGGTCCCAGGGGTTGG + Intergenic
937221714 2:120346012-120346034 TGCCGCCGGCTCGCAGGGGGAGG - Intergenic
940316835 2:152335582-152335604 TGTCGGCGGCGCGCCGGGGCCGG - Exonic
940453738 2:153871874-153871896 GGGAGGCGGCGGGCTGGGGTGGG + Intergenic
941580692 2:167293115-167293137 CGCCGGCGGCGCGGCGGGGTGGG - Intergenic
941929924 2:170929274-170929296 AGCAGGCGGTGCGCTGGGGGCGG + Exonic
944413614 2:199463628-199463650 TGCAGGCGACGCGGAAGGGTTGG - Intronic
946200483 2:218068277-218068299 TGCTGGAGGAGCGCAGGGGCAGG + Intronic
946386615 2:219387813-219387835 GGCAGGCGGCGCGGTGGGGGCGG - Exonic
948542895 2:238702785-238702807 TGCAGGCTACGAGCAGGGGTGGG - Intergenic
948696500 2:239735626-239735648 TGCAGGCAGCCGGCACGGGTGGG + Intergenic
948890994 2:240907042-240907064 TGCAGGCTGCGCACTGGGGTGGG + Intergenic
1169190838 20:3658421-3658443 TGGAGGAGGCGGGCAGGGGCGGG + Intergenic
1172282845 20:33720210-33720232 TGCGGGCTGCGCGCAGGGTCGGG + Exonic
1172297982 20:33827124-33827146 TGGAGGGGGCACCCAGGGGTAGG - Intronic
1173279749 20:41618011-41618033 TGCGGGCCGCGCGCAGGGGCGGG - Intronic
1175260671 20:57672368-57672390 GGCGGGCGGCGCCCAGGGGAGGG + Intronic
1175784875 20:61706132-61706154 AGCAGGCGCCGGGCAGGCGTCGG - Intronic
1176427322 21:6556829-6556851 TGCAGGTGGCGGGCAGGGGGAGG - Intergenic
1176521900 21:7830408-7830430 TGCAGGCGGGTCGCAGAGGCAGG + Intergenic
1177142216 21:17369504-17369526 AGCAAGAGGCGGGCAGGGGTGGG - Intergenic
1178431934 21:32525235-32525257 TGCAGGTGGGGTGCAGGGGCAGG - Intergenic
1178655920 21:34460420-34460442 TGCAGGCGGGTCGCAGAGGCAGG + Intergenic
1179209555 21:39313613-39313635 TCCAGGCGGCGCGCACGGTATGG - Exonic
1179511560 21:41877209-41877231 GGCAGGTGGCGGGCAGGGGATGG - Intronic
1179522379 21:41953751-41953773 TGGAGGGGGCGCGGCGGGGTCGG + Exonic
1179702813 21:43165146-43165168 TGCAGGTGGCGGGCAGGGGGAGG - Intergenic
1179912317 21:44456722-44456744 GGCAGGCGGCGCCCAGGTGCAGG - Exonic
1179987012 21:44927679-44927701 TGCAGGCTGGGGGCAGGGGCGGG + Intronic
1179998656 21:44985306-44985328 GGCAGGTGGGGCGCAGGGGCAGG + Intergenic
1180064322 21:45405110-45405132 GGCAGGGGGCGGGCAGGGGCCGG - Intergenic
1181030507 22:20147120-20147142 TCCAGGGGGCCCGCAGTGGTGGG - Exonic
1181512796 22:23396251-23396273 TCCAGGGGGCCCGCAGTGGTGGG + Intergenic
1182234263 22:28863288-28863310 GGCAGGGGGCTGGCAGGGGTAGG - Intergenic
1183515911 22:38265971-38265993 TGCAGGCAGTCCACAGGGGTTGG + Intronic
1183622996 22:38985748-38985770 AGCAGGAGGAGTGCAGGGGTGGG - Intronic
1183628216 22:39017701-39017723 AGCAGGAGGAGTGCAGGGGTGGG - Intronic
1183633001 22:39044877-39044899 AGCAGGAGGAGTGCAGGGGTGGG - Intronic
1183634332 22:39052009-39052031 AGCAGGAGGAGTGCAGGGGTGGG - Intronic
1183638761 22:39080870-39080892 AGCAGGAGGAGAGCAGGGGTGGG - Intronic
1183780354 22:39995234-39995256 TCCAGGCGGCCCGCAGGGCCTGG - Exonic
1184169157 22:42748925-42748947 TGCAGGCGGAGGGGAGGGATTGG - Intergenic
1185258261 22:49848547-49848569 TCCAGGCGGCGGCCGGGGGTGGG - Intergenic
950024353 3:9810265-9810287 CTGAGGCGGCGCGCAGGGGCGGG - Exonic
954085538 3:48241260-48241282 CGCAGGCGCCGCGCAGGCGTCGG + Intronic
954633160 3:52057618-52057640 CGCAGGCGGCGCGCTTGCGTAGG + Intergenic
958464646 3:94442842-94442864 TGCAGCCGGTGCGCAGCGCTAGG - Intergenic
959539813 3:107525075-107525097 TGGCGGCGGCGCGCAGGGGCGGG - Intronic
960628337 3:119702999-119703021 GGCCGCCGGCGCGCAGGGATAGG - Intergenic
961358969 3:126355958-126355980 CGCAGGCTGCGTGCAGGGGGAGG + Intronic
961521050 3:127467544-127467566 TGCAGCAGGCGAGCGGGGGTGGG - Intergenic
966182167 3:177197392-177197414 GGGAGGCGGCGCGCGGGGGAAGG + Intronic
966726884 3:183116283-183116305 TGCAGCCAGTGCGCACGGGTAGG - Intergenic
969032759 4:4227292-4227314 TGCAGACGGCGGGCGGGGGCCGG - Intergenic
969239064 4:5887860-5887882 CGCAGGCCTCGCGCGGGGGTGGG - Intronic
972670950 4:41214007-41214029 TGGAGGCGGTGCGCCCGGGTGGG - Intronic
976091294 4:81460676-81460698 AGCAGGGGGCGGCCAGGGGTGGG + Intronic
989230459 5:39080540-39080562 TGAAGGGGGCACGTAGGGGTAGG + Intergenic
990447261 5:55904443-55904465 TCCAGGCGGTGAGCAGGGGAAGG + Intronic
990910173 5:60844343-60844365 TGGCGGCGGCGGGCAGGGGGCGG - Exonic
992211064 5:74479944-74479966 TGCAGGGGCCGCAGAGGGGTTGG + Intergenic
998130324 5:139648507-139648529 AGCAGGCGGCGCGCATGGCTGGG - Exonic
999976912 5:156921121-156921143 TGGGGGCGGGGGGCAGGGGTGGG + Intronic
1001106811 5:168861392-168861414 TGGGGGCGGGGGGCAGGGGTTGG - Intronic
1002101596 5:176860648-176860670 TGCAGGCGACGCTGGGGGGTGGG - Intronic
1002580870 5:180208933-180208955 TGCCGGCGGCGCGGCGGGGTCGG - Intronic
1003459919 6:6320151-6320173 GGCAGGCGATGCGCAGGAGTGGG + Intronic
1004497666 6:16180347-16180369 AGCAGGCTGCGGGCGGGGGTGGG - Intergenic
1006189234 6:32197390-32197412 AGGAGGCGGCGGGCAGCGGTTGG + Exonic
1007553597 6:42747624-42747646 CGCAGGCGGGGCGCGGGGGCAGG + Intronic
1008602328 6:53108341-53108363 GGCAGGGGGCACGCAGGGCTAGG - Intergenic
1013366373 6:109440995-109441017 CGCAGGCGGCGCGCACAGGTGGG - Exonic
1015625988 6:135181436-135181458 GGCAGGCGGCGGGCAGCGGGAGG + Exonic
1015943331 6:138474136-138474158 TGCTGGCGGCTCTCATGGGTGGG + Intronic
1018417237 6:163611936-163611958 TGCAGGCGGGCCTCAGGTGTGGG + Intergenic
1018613299 6:165662901-165662923 TTCGGGCGGCCGGCAGGGGTGGG - Intronic
1018923446 6:168191150-168191172 TGCAGGCAGCTCGCAGGAGGTGG + Intergenic
1019365463 7:630397-630419 GGCAGGCAGCGGGCAGCGGTTGG + Intronic
1019422667 7:958329-958351 TCCAGGCTCAGCGCAGGGGTGGG + Intronic
1019474181 7:1236190-1236212 TGCAGGCGGCTCGCCGGGAGGGG - Exonic
1019563753 7:1669970-1669992 TCCCGGCGACGCGCAGGGGCTGG - Intergenic
1019588700 7:1818168-1818190 TGCAGCTGCCGGGCAGGGGTGGG + Intronic
1019636270 7:2077677-2077699 TGCAGGAGGCGCGCGGGAGCAGG + Intronic
1019734344 7:2643499-2643521 TGCAGGCGGCGCCAAGGGCAAGG + Intronic
1022653576 7:32298548-32298570 GGCAGGGGGAGCTCAGGGGTCGG - Intronic
1022923267 7:35037194-35037216 GGCGGGCGGCGCGCCGGGCTCGG + Intronic
1023355025 7:39357792-39357814 TGCAGGTGGCACGGAGGGGAAGG + Intronic
1031009776 7:116513865-116513887 TGCAGGGGCCACGCAGGGGATGG + Intergenic
1034275873 7:149823654-149823676 TGCAGGCGGGGCACAGTGCTGGG + Intergenic
1036379499 8:8227936-8227958 TGCAGGCTGCGCTCAGGAGGCGG - Intergenic
1037885558 8:22594418-22594440 TGCAGGCAACTGGCAGGGGTGGG - Intronic
1038544044 8:28412086-28412108 TGCAGGCGGCGCGCAGGGGTGGG - Intronic
1039050051 8:33484761-33484783 TGCAGGCGGCGCGGCGGGGCTGG - Exonic
1039467867 8:37796961-37796983 AGCAGGCGACGCGGAGGGGCCGG + Intronic
1042591502 8:70402787-70402809 TGCAGGAGGCGCGCTGGGGCCGG - Intronic
1044793515 8:95872485-95872507 GGCAGGGGGCTGGCAGGGGTGGG - Intergenic
1045231408 8:100310169-100310191 CGCGGGCGGCGCGCTGGGGCGGG - Intronic
1050428013 9:5532221-5532243 TGCAGGAGGGGCACAGGGGCAGG - Intronic
1052365090 9:27603331-27603353 TGCAGGAGGGGTGCAGGGGGCGG - Intergenic
1053122717 9:35558614-35558636 TGCAGGCAGAGCCCGGGGGTGGG - Intronic
1053804234 9:41784742-41784764 TGGAGGCGGAGCTCAGGGGCAGG + Intergenic
1054141048 9:61530717-61530739 TGGAGGCGGAGCTCAGGGGCAGG - Intergenic
1054192541 9:61996237-61996259 TGGAGGCGGAGCTCAGGGGCAGG + Intergenic
1054645864 9:67592454-67592476 TGGAGGCGGAGCTCAGGGGCAGG - Intergenic
1055018746 9:71646674-71646696 TCCAGGTGGTGGGCAGGGGTCGG + Intergenic
1055069208 9:72149385-72149407 TGCAGGCCGCGCCCAGGGGCTGG - Exonic
1056659735 9:88535071-88535093 TGTGGGCGGGGCGCAGTGGTGGG + Intergenic
1057198161 9:93126621-93126643 TGCAGCCGGCCCGCTGGGGCTGG - Exonic
1057928107 9:99170742-99170764 TGAAGCCGGGGAGCAGGGGTGGG + Intergenic
1058662994 9:107283339-107283361 TGCAGAAGGCGCGAGGGGGTCGG - Exonic
1060951768 9:127608527-127608549 TGCTGGCCCAGCGCAGGGGTGGG - Intergenic
1061794800 9:133080099-133080121 TGCAGTCGGCTGGCAGGGCTGGG + Intronic
1062019869 9:134314175-134314197 TGCTGGCTGGGCGCAGGGCTGGG + Intergenic
1062429283 9:136519852-136519874 TGCAGGCGGCACCCAGGTGCAGG - Intronic
1062480054 9:136746913-136746935 TGGTGGCGGCGTGCAGGGGTCGG - Intronic
1062584988 9:137245169-137245191 TGCTGGCGGCGGGCGGGGGGTGG + Exonic
1187281470 X:17861005-17861027 CGCAGGGGGCGCGCCGGGCTGGG - Intronic
1187959859 X:24558169-24558191 GGCAGGGGGCGCGCAGAGTTGGG + Intronic
1190078592 X:47337253-47337275 TGCAGGTGGCAGCCAGGGGTGGG + Intergenic
1192264982 X:69531757-69531779 TGTAGGCAGGGCACAGGGGTAGG - Exonic
1196116630 X:112005971-112005993 TGGCGGCGGGGGGCAGGGGTTGG + Intronic
1198424022 X:136497145-136497167 GGGAGGCGGGGCGCCGGGGTTGG - Exonic
1200231143 X:154444446-154444468 CGCGGGCGGCGCGCCGGGGCAGG + Intronic
1200267677 X:154654473-154654495 TGCGAGAGGCGGGCAGGGGTGGG + Intergenic