ID: 1038545958

View in Genome Browser
Species Human (GRCh38)
Location 8:28425872-28425894
Sequence CAGGGGGTGAGGCGGGAGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 3806
Summary {0: 1, 1: 1, 2: 26, 3: 395, 4: 3383}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1038545958_1038545968 -5 Left 1038545958 8:28425872-28425894 CCATCCTCCCGCCTCACCCCCTG 0: 1
1: 1
2: 26
3: 395
4: 3383
Right 1038545968 8:28425890-28425912 CCCTGAGTAGCTGGGACCGCAGG 0: 2
1: 234
2: 7563
3: 61083
4: 182378
1038545958_1038545970 9 Left 1038545958 8:28425872-28425894 CCATCCTCCCGCCTCACCCCCTG 0: 1
1: 1
2: 26
3: 395
4: 3383
Right 1038545970 8:28425904-28425926 GACCGCAGGCACATGCTGCCTGG 0: 1
1: 0
2: 3
3: 52
4: 364

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1038545958 Original CRISPR CAGGGGGTGAGGCGGGAGGA TGG (reversed) Intronic
Too many off-targets to display for this crispr