ID: 1038552519

View in Genome Browser
Species Human (GRCh38)
Location 8:28482277-28482299
Sequence AAATAGTGCCTCTCATAGCG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1038552513_1038552519 28 Left 1038552513 8:28482226-28482248 CCCAGACTGGACAGGGAGAAGCA 0: 1
1: 0
2: 2
3: 27
4: 385
Right 1038552519 8:28482277-28482299 AAATAGTGCCTCTCATAGCGGGG No data
1038552514_1038552519 27 Left 1038552514 8:28482227-28482249 CCAGACTGGACAGGGAGAAGCAG 0: 1
1: 0
2: 3
3: 30
4: 281
Right 1038552519 8:28482277-28482299 AAATAGTGCCTCTCATAGCGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1038552519 Original CRISPR AAATAGTGCCTCTCATAGCG GGG Intronic
No off target data available for this crispr