ID: 1038555020

View in Genome Browser
Species Human (GRCh38)
Location 8:28505176-28505198
Sequence CTGGATCAGTAGAGGGATGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1038555020_1038555028 6 Left 1038555020 8:28505176-28505198 CCTCCATCCCTCTACTGATCCAG No data
Right 1038555028 8:28505205-28505227 GCTTAGCAGGCACAAGTAATTGG No data
1038555020_1038555025 -7 Left 1038555020 8:28505176-28505198 CCTCCATCCCTCTACTGATCCAG No data
Right 1038555025 8:28505192-28505214 GATCCAGGAACCAGCTTAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1038555020 Original CRISPR CTGGATCAGTAGAGGGATGG AGG (reversed) Intronic
No off target data available for this crispr