ID: 1038555020

View in Genome Browser
Species Human (GRCh38)
Location 8:28505176-28505198
Sequence CTGGATCAGTAGAGGGATGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 267
Summary {0: 1, 1: 0, 2: 2, 3: 26, 4: 238}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1038555020_1038555025 -7 Left 1038555020 8:28505176-28505198 CCTCCATCCCTCTACTGATCCAG 0: 1
1: 0
2: 2
3: 26
4: 238
Right 1038555025 8:28505192-28505214 GATCCAGGAACCAGCTTAGCAGG No data
1038555020_1038555028 6 Left 1038555020 8:28505176-28505198 CCTCCATCCCTCTACTGATCCAG 0: 1
1: 0
2: 2
3: 26
4: 238
Right 1038555028 8:28505205-28505227 GCTTAGCAGGCACAAGTAATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1038555020 Original CRISPR CTGGATCAGTAGAGGGATGG AGG (reversed) Intronic
900762350 1:4481780-4481802 CAGGATCATTAGAGGCCTGGAGG - Intergenic
900993093 1:6106880-6106902 GTGGAGCAGTGGAAGGATGGAGG + Intronic
901737542 1:11321998-11322020 CAGGCTCAGCAGAAGGATGGAGG - Intergenic
901763071 1:11483087-11483109 CGGGACCAGTCCAGGGATGGCGG + Intronic
902722174 1:18311251-18311273 CTGGATGGGGAGAGGCATGGTGG - Intronic
903568244 1:24285058-24285080 CTGCATGAGGAGCGGGATGGAGG - Intergenic
903670320 1:25031454-25031476 CTGGAGCAATACAAGGATGGAGG + Intergenic
904581677 1:31548473-31548495 CTCGAGGAGAAGAGGGATGGGGG + Intergenic
907684224 1:56594303-56594325 CTGAATAACTAGAAGGATGGAGG + Intronic
908741138 1:67328866-67328888 CTGGCTCACTCCAGGGATGGAGG - Intronic
908973273 1:69864345-69864367 TTGGATGAATAGATGGATGGAGG + Intronic
912170807 1:107097191-107097213 GTGGACCACTAGAGGGTTGGGGG - Intergenic
917693692 1:177495819-177495841 CAGGATCTGTTGTGGGATGGAGG - Intergenic
918043787 1:180928799-180928821 CTGGATCCCTGGGGGGATGGAGG + Intronic
918437870 1:184534973-184534995 CTGGATCTGGAGAGGCATGGTGG + Intronic
919935161 1:202246170-202246192 ATGGATGGGTGGAGGGATGGAGG - Intronic
919935207 1:202246291-202246313 ATGGATGGGTGGAGGGATGGAGG - Intronic
920258176 1:204670799-204670821 CTGCTTCAGCAGAGTGATGGGGG + Intronic
920534694 1:206729872-206729894 CTGGATGAGTAGAGGAAGGGAGG + Intronic
921757970 1:218881518-218881540 CTGGATAAGTCGAAGGGTGGAGG + Intergenic
922342415 1:224668658-224668680 CTGGACCAGAAGAAGGAGGGAGG + Intronic
923149314 1:231219385-231219407 ATGGATCTGTAGAGGGACTGTGG + Intronic
923850094 1:237784856-237784878 CTGGATCTGAAGAGAGAAGGAGG + Exonic
924718392 1:246600258-246600280 GTAGAGCAGTAGAGAGATGGAGG + Intronic
1063073321 10:2689156-2689178 TTGGATGAGTGGATGGATGGAGG - Intergenic
1066721840 10:38347587-38347609 TTAGAGCAGTAGAGGGAGGGAGG - Intergenic
1067945708 10:50686837-50686859 CTGCATCAGGAGAGGGACCGAGG + Intergenic
1070867220 10:79713710-79713732 CTGCATCAGGAGAGGGACCGAGG + Intronic
1070881012 10:79851834-79851856 CTGCATCAGGAGAGGGACCGAGG + Intergenic
1071634134 10:87235934-87235956 CTGCATCAGGAGAGGGACCGAGG + Intronic
1071647584 10:87368151-87368173 CTGCATCAGGAGAGGGACCGAGG + Intronic
1073466781 10:103698884-103698906 TTGGATCCATAGAGGGATGCAGG + Intronic
1075020505 10:118948718-118948740 CTGGATTTGCAGAGGGAGGGAGG - Intergenic
1075163401 10:120044214-120044236 CTGGAGCTGTTGAGGGAGGGTGG - Intergenic
1075642057 10:124072002-124072024 CTGGGTAAGGAGAGGAATGGAGG - Intronic
1076352262 10:129825369-129825391 CTGCAGCAGCAGAGGGAGGGAGG + Intergenic
1076565340 10:131394685-131394707 ATGGATGAGTGGATGGATGGAGG + Intergenic
1077061843 11:620992-621014 CAGGATCAGGAGAGGAAGGGCGG - Intronic
1077131210 11:973677-973699 CTGGTGCAGGAGAGGGAGGGTGG + Intronic
1077357954 11:2127285-2127307 ATGGATGGGTGGAGGGATGGGGG + Intergenic
1078690906 11:13579607-13579629 CTGGACCTGTACTGGGATGGAGG + Intergenic
1079104922 11:17564437-17564459 CTGGGTAAGGAGAGGGAGGGAGG + Intronic
1079398013 11:20082722-20082744 CTGGCTCAGCAGATGGATGTTGG - Intronic
1083159961 11:60848711-60848733 CTGGGTCATTAGAGGAGTGGAGG - Intronic
1084026888 11:66456155-66456177 CTGGAGCAGGGGAGGGAGGGAGG + Intronic
1084784926 11:71436801-71436823 CAGAATCAATAGAGGGGTGGAGG - Intronic
1091899570 12:4134159-4134181 CTGGACCAGTAGCAGGCTGGTGG - Intergenic
1092231805 12:6779937-6779959 CTGGAGCAGGAGGGGCATGGTGG + Intergenic
1092236579 12:6814455-6814477 CTTGATCAGGTGAGGGATGCTGG + Intronic
1092278369 12:7080543-7080565 CTGGATCAAGAAAGAGATGGAGG - Exonic
1093863244 12:24193981-24194003 ATCAATCAGTAGAGGGATGAGGG - Intergenic
1093947925 12:25131536-25131558 CCGGATCACTAAAGGGGTGGAGG + Intronic
1095243018 12:39883290-39883312 CTGAATCAGGAGAGTGATGGTGG - Intronic
1095946882 12:47758749-47758771 TTGGGTGAGTAGAGGGGTGGGGG + Intronic
1096243005 12:49969270-49969292 CTGGAACAGTGGAGGCATTGAGG + Intronic
1098461860 12:70741385-70741407 CTGAATCAGTAGTGGGCTGGAGG + Intronic
1101837012 12:108302919-108302941 ATGGAGAAGTGGAGGGATGGAGG + Intronic
1102637785 12:114339440-114339462 CTGGAGCAGTGGAGGGCGGGAGG + Intergenic
1102742769 12:115222850-115222872 CTGGTTCAGTACAGGGAGAGTGG + Intergenic
1102856098 12:116295464-116295486 ATGGATGGGTAGATGGATGGAGG + Intergenic
1103023991 12:117558687-117558709 ATGGATGGGTAGATGGATGGGGG + Intronic
1103540912 12:121665819-121665841 CTGAATCAGTTGAGGGTTCGGGG + Intronic
1105279610 13:18955767-18955789 ATGGATGGGTAGATGGATGGGGG - Intergenic
1106713550 13:32364514-32364536 CTGTATTAGTAGAGGGAAGATGG - Intronic
1106900583 13:34351269-34351291 ATGGATGAGTAGAGGGATGATGG + Intergenic
1106900610 13:34351423-34351445 ATGAATGAGTAGAGGGATGATGG + Intergenic
1107347826 13:39481900-39481922 CTGGAGCAGTAGAGAGATGATGG + Intronic
1107348049 13:39484301-39484323 CTGGAGCAGTGGATAGATGGTGG - Intronic
1112595708 13:100805138-100805160 CTGGATCCCTGGAGGGATGGAGG - Intergenic
1114695942 14:24627853-24627875 CTGGAGGAAAAGAGGGATGGTGG + Intergenic
1119665194 14:76480367-76480389 CTGGGGCAGCAGAGGGGTGGGGG + Intronic
1120249748 14:82048937-82048959 CCGGAACAGTGGAGGAATGGGGG + Intergenic
1120831280 14:88999835-88999857 CTGGATCAGTGGAGATAAGGTGG - Intergenic
1120881096 14:89416376-89416398 CTGGATAAGTTGGGGGACGGCGG - Intronic
1121016195 14:90550806-90550828 CTGGATAGATGGAGGGATGGAGG + Intronic
1122140943 14:99662728-99662750 GTGGATATGTAGATGGATGGTGG + Intronic
1122600722 14:102920394-102920416 ATGGATGGGTAGATGGATGGTGG - Intergenic
1125432135 15:39606035-39606057 CTAGATTAGCAGAGGGAGGGTGG - Intronic
1128565967 15:68700536-68700558 CTGGATCCCTGGCGGGATGGAGG - Intronic
1128793740 15:70450336-70450358 ATGGATGAATAGAGGGATGGAGG + Intergenic
1129503931 15:76065308-76065330 CTGTTTCAGTAGAGGGGTGGGGG - Intronic
1132977875 16:2719621-2719643 CAGGCTCAGTAGAGAGCTGGGGG - Intronic
1133293932 16:4740798-4740820 CTGTCTCAGTAGAGGGGTGGAGG + Intronic
1135867897 16:26121548-26121570 TTGGATCAGTAGCAGGATGCAGG + Intronic
1136519441 16:30786666-30786688 CTGTATCAGCAGCGGGACGGGGG - Intronic
1137386094 16:48043974-48043996 GTGGATCAATGGATGGATGGTGG - Intergenic
1137795943 16:51220023-51220045 TGGTATCAGTGGAGGGATGGAGG + Intergenic
1142152351 16:88518250-88518272 GTGGGTGAGTAGATGGATGGTGG + Intronic
1143874316 17:9980346-9980368 CTGGATCGGAAGAGGGAGGTGGG - Intronic
1146734900 17:35230356-35230378 CAGGATGAATAGAGGGAAGGGGG + Intergenic
1146821730 17:35988508-35988530 GTGGGTCAGTAGTGGGATGATGG + Intronic
1148889707 17:50798876-50798898 CTGGATCAGGAGAGAGCAGGAGG + Intergenic
1149624402 17:58069874-58069896 CTGGATCAGTTGAGGGTTGAGGG + Intergenic
1150266861 17:63837694-63837716 CTGGCTGACGAGAGGGATGGAGG - Intronic
1152239661 17:79154813-79154835 CTTGCTCAGTAGAGGGTTTGGGG - Intronic
1154382682 18:13866927-13866949 CTGGATAATTAGAAAGATGGTGG - Intergenic
1155518177 18:26643482-26643504 CAGGATTAGTAGAGCCATGGTGG + Intronic
1159074806 18:63668283-63668305 AGGGACCAGTAGGGGGATGGGGG - Intronic
1159913921 18:74172243-74172265 CCGGATCAGTAGAGGTGAGGAGG + Intergenic
1160136699 18:76277882-76277904 ACGGAGCAGTAGAGAGATGGGGG - Intergenic
1160514889 18:79472743-79472765 CAGGATCAGATGAGGGAAGGCGG - Intronic
1161681420 19:5681551-5681573 ATGGATGAGTGGAAGGATGGGGG - Intronic
1161857888 19:6776197-6776219 ATGGATGAGCAGATGGATGGAGG - Intronic
1162044529 19:7989700-7989722 CTGGAGCAGGAGAGAGATGCTGG + Intronic
1162085808 19:8248519-8248541 TTGGATCAGTGGATGGATGATGG + Intronic
1162988798 19:14289109-14289131 CTGGACCAGGTGAGGGATGCTGG + Intergenic
1163382706 19:16979295-16979317 ATGGATGAATAGATGGATGGAGG - Intronic
1163394709 19:17052967-17052989 CTGGAGGGGAAGAGGGATGGTGG + Intronic
1164827214 19:31292640-31292662 ATGGATGGGTAGATGGATGGAGG - Intronic
1166670245 19:44705544-44705566 ATGGGGCAGTAGAGGGAAGGAGG - Intronic
1168651966 19:58097586-58097608 CTGGAGCAGGGAAGGGATGGAGG - Intronic
925247898 2:2401045-2401067 CTGGACCACAAGAGGGAGGGAGG - Intergenic
930516333 2:52412118-52412140 CAGGAACAGTAGAGCGATGGGGG - Intergenic
936148161 2:109995677-109995699 CTGGATCTGTGGTGAGATGGGGG + Intergenic
936148228 2:109995997-109996019 CTGGATCTGTGGTGAGATGGGGG + Intergenic
936196448 2:110375371-110375393 CTGGATCTGTGGTGAGATGGGGG - Intergenic
936196532 2:110375771-110375793 CTGGATCTGTGGTGAGATGGGGG - Intergenic
936468920 2:112780502-112780524 CTTGTACAGTAAAGGGATGGAGG + Intronic
937082641 2:119151402-119151424 ATGGATGGATAGAGGGATGGAGG - Intergenic
937100505 2:119264631-119264653 CTGGTTCTGCAGAGGGTTGGGGG - Exonic
939820779 2:146954667-146954689 CCGGAGCAGTTGTGGGATGGTGG + Intergenic
940507955 2:154579800-154579822 CAGGATCAGTCGAGGGGTAGCGG - Intergenic
943959077 2:194236832-194236854 CTGTATCATTAGAGAGATTGAGG + Intergenic
943995202 2:194754480-194754502 CTAGATCAGTACAAGGATAGTGG + Intergenic
946882696 2:224192382-224192404 CAGGATCAGTAGAGAGGTAGAGG + Intergenic
948458489 2:238118210-238118232 ATGGAGCAGCAGATGGATGGAGG + Intronic
948532004 2:238614926-238614948 ATGGATAAGTGGATGGATGGGGG - Intergenic
1170405605 20:16032668-16032690 ATGGATGAGAAGAGGGAAGGAGG + Intronic
1170843198 20:19940540-19940562 GTAGATCAGCAGAGGCATGGAGG - Intronic
1170862170 20:20116748-20116770 CAGGAAGAGTAGAGGGGTGGGGG - Intronic
1171182099 20:23098376-23098398 GTGGATCACTGGACGGATGGTGG - Intergenic
1175392972 20:58638753-58638775 ATGGGTCAGTAGGTGGATGGTGG - Intergenic
1175530696 20:59672745-59672767 GTGGATGAGGAGAGAGATGGTGG - Intronic
1175723637 20:61302583-61302605 CAGGATGACTTGAGGGATGGAGG - Intronic
1175817855 20:61892986-61893008 ATGGGTGAGTAGAGGGATGGTGG + Intronic
1175817876 20:61893069-61893091 ATGGGTGAGTAGAGGGATGCTGG + Intronic
1175817896 20:61893148-61893170 GTGGGTGAATAGAGGGATGGTGG + Intronic
1175817959 20:61893385-61893407 ATGGGTGAATAGAGGGATGGTGG + Intronic
1175817978 20:61893468-61893490 GCGGATGAGTAGAGGGATGGTGG + Intronic
1175818037 20:61893706-61893728 ATGGGTGAATAGAGGGATGGTGG + Intronic
1175818051 20:61893757-61893779 ATGGGTGAATAGAGGGATGGTGG + Intronic
1175818064 20:61893804-61893826 ATGGGTGAATAGAGGGATGGTGG + Intronic
1175934626 20:62509265-62509287 GTGGAGGAGTAGAGGGATGGAGG - Intergenic
1175935110 20:62510581-62510603 ATGGAGAGGTAGAGGGATGGAGG - Intergenic
1176044514 20:63085418-63085440 CAGGAACAGCAGAGGGAGGGAGG + Intergenic
1176551761 21:8226051-8226073 AAGGATCAGTAGAGCGATGGTGG - Intergenic
1176570670 21:8409050-8409072 AAGGATCAGTAGAGCGATGGTGG - Intergenic
1176578579 21:8453217-8453239 AAGGATCAGTAGAGCGATGGTGG - Intergenic
1178222919 21:30681359-30681381 CAGGAAGAGTAGAGGGAAGGGGG + Intergenic
1179644116 21:42765151-42765173 GTGGATGGGTAGATGGATGGAGG + Intronic
1184293416 22:43509750-43509772 GTGGATGAATGGAGGGATGGAGG - Intergenic
1184460302 22:44634061-44634083 ATGGATAAGTTGATGGATGGGGG + Intergenic
1184610987 22:45602964-45602986 CTGGAGCAGAAGAGGGCAGGAGG + Intergenic
1185146282 22:49138578-49138600 GTGGATGAATAGATGGATGGAGG - Intergenic
1185146325 22:49138785-49138807 ATGGATGGGTATAGGGATGGAGG - Intergenic
1185414453 22:50702150-50702172 CTGGACCAGTGGATGGAGGGAGG - Intergenic
1203256780 22_KI270733v1_random:142971-142993 AAGGATCAGTAGAGCGATGGTGG - Intergenic
950793183 3:15489604-15489626 CTGGATCAGAAGAAGCGTGGTGG - Exonic
951806492 3:26649928-26649950 CTGGATAAGTAGAGGGAAAGAGG - Intronic
952577173 3:34789477-34789499 CTGGAACAGCAGAGGGACAGTGG - Intergenic
954516106 3:51178600-51178622 CTGGAACAGTAAAGAGCTGGAGG - Intronic
954828680 3:53399244-53399266 ATGGATTAATAGATGGATGGAGG - Intergenic
954993987 3:54865417-54865439 GGGGATCAGTAGCGGGAAGGTGG - Intronic
955575720 3:60360782-60360804 CTGGGTCAGTGGAGACATGGTGG - Intronic
955824263 3:62928672-62928694 ATGGATGAATAGATGGATGGGGG + Intergenic
956740627 3:72272949-72272971 GTCGAAGAGTAGAGGGATGGAGG + Intergenic
958989990 3:100831705-100831727 CTGGATGAGTAGAGGGATGAGGG - Intronic
959034842 3:101349054-101349076 CTGGTTCAGTAGATGTAAGGTGG - Intronic
960042474 3:113164519-113164541 CTGGGCCTGTAGAGGGGTGGGGG + Intergenic
960291571 3:115891778-115891800 ATGGAAGAGAAGAGGGATGGTGG - Intronic
961094828 3:124145205-124145227 CTGGATCAGTAGATCGATAAAGG - Intronic
961454370 3:127016921-127016943 CTGGAACAGGACAGGGGTGGGGG - Intronic
962612610 3:137092497-137092519 TAGTATCAATAGAGGGATGGAGG - Intergenic
964708895 3:159650178-159650200 CTGGAGCATGAGAGAGATGGAGG + Intronic
966237072 3:177713717-177713739 CTGAATCATTAAAGGGAAGGGGG - Intergenic
966887474 3:184384731-184384753 CTAGAACATTTGAGGGATGGTGG + Intronic
967720645 3:192812453-192812475 CTGAATCAGTAAATAGATGGTGG + Intronic
968192330 3:196677888-196677910 CAAGAACAGTGGAGGGATGGGGG - Intronic
969112789 4:4854074-4854096 CTGGAGCAGTGGAGCGATCGCGG + Intergenic
977307542 4:95343065-95343087 CTGGATCCGCACAGGGCTGGGGG + Intronic
978264027 4:106800682-106800704 CTTGTTGAGTAGAGGCATGGAGG + Intergenic
979774032 4:124564878-124564900 CTAGATCAGTAGAGGATTCGGGG + Intergenic
980890734 4:138812252-138812274 GGGGAGCAGGAGAGGGATGGAGG + Intergenic
982742612 4:159073625-159073647 CTGGATTAGGAGAGGGAGGATGG - Intergenic
984220386 4:176967484-176967506 GGGGATCAGCAGAGGCATGGAGG + Intergenic
984822837 4:183898160-183898182 CTGGAGAAGGAGAGGGAGGGCGG - Intronic
985953964 5:3247966-3247988 CTGGACCTGTCGGGGGATGGGGG - Intergenic
986072880 5:4304434-4304456 CTGGATGAATAGATGGATGATGG - Intergenic
986139948 5:5020103-5020125 CAGGATCAGAAGAGTGATGGAGG + Intergenic
990388360 5:55291475-55291497 GTGCATAAGTGGAGGGATGGTGG - Intronic
991698965 5:69299440-69299462 ATGGAGCAGTAGAGTGATAGGGG - Intronic
991963170 5:72065758-72065780 CTGGATCACATGAGAGATGGAGG - Intergenic
996250032 5:121318089-121318111 CTGAAAAAGTAAAGGGATGGTGG + Intergenic
997361461 5:133297897-133297919 CTGGTCCAGATGAGGGATGGGGG - Intronic
998093673 5:139384930-139384952 CTGGAACAGGTGAAGGATGGAGG + Intergenic
998147031 5:139734796-139734818 CTGGATCAGCAGAGGCAGGCAGG - Intergenic
999598354 5:153232077-153232099 CTGGATAAGTGCAGGGGTGGGGG - Intergenic
1000015097 5:157268841-157268863 CTGCATCAGTAGTGAGATGGTGG + Intronic
1001233402 5:170009363-170009385 CCTGATCAGTAAAAGGATGGGGG - Intronic
1001960127 5:175874998-175875020 GTGATTCAGCAGAGGGATGGAGG + Intronic
1002209402 5:177587707-177587729 CTGCATCTGGAAAGGGATGGAGG + Intergenic
1003550934 6:7101461-7101483 CTGGAGCAGCAGAGGGAGGAGGG - Intergenic
1003972587 6:11313350-11313372 ATGGCTGAGTAGATGGATGGTGG + Intronic
1007482928 6:42162044-42162066 CTGGGTAGGTGGAGGGATGGAGG + Intronic
1007781687 6:44258024-44258046 AAGGATGAGTAAAGGGATGGGGG - Intergenic
1008401486 6:51068644-51068666 CAGGAACAGGAGAGAGATGGGGG + Intergenic
1010373904 6:75144142-75144164 CTGGAACAGTAGAGGAATGGAGG - Intronic
1011418536 6:87148568-87148590 CTGTATCAGAAGAGGTATGCAGG - Intergenic
1015890771 6:137967813-137967835 CTGGGACAGCAGAGTGATGGTGG - Intergenic
1015890788 6:137967883-137967905 CTGGGACAGCAGAGTGATGGTGG - Intergenic
1015890817 6:137968014-137968036 CTGGATCATCAGAGCGATGGTGG - Intergenic
1016798382 6:148142873-148142895 ATGGATCAGCAAGGGGATGGGGG - Intergenic
1018673120 6:166195778-166195800 CTGGAATAGTAGAGGGAATGCGG + Intergenic
1022412303 7:30148660-30148682 GTGGATCAGAAGTGGGATGTGGG + Intronic
1024724773 7:52180130-52180152 CTGGAGCAGTAGGTGGAGGGCGG + Intergenic
1026216146 7:68350876-68350898 TTGGATCAGTAGAAGGAGAGAGG + Intergenic
1028076851 7:86527094-86527116 TTGGACCAGCAGAAGGATGGAGG - Intergenic
1029363601 7:100103516-100103538 CTTGGTCAGTAGAGGGAAAGAGG + Exonic
1029815032 7:103084889-103084911 CTGGATCAGTCGAGGGACCATGG + Intronic
1030761440 7:113357294-113357316 TTGGATCAGTTTTGGGATGGGGG + Intergenic
1031518687 7:122735640-122735662 TTGGATCAGCAGGGGGATGAGGG - Intronic
1032067432 7:128782271-128782293 ATGGATGTGTACAGGGATGGTGG + Intergenic
1032516376 7:132509150-132509172 CTGGAGGAGAAGAGGGAGGGAGG + Intronic
1034259957 7:149748922-149748944 CTGCTTCAGTAGAATGATGGTGG - Intergenic
1035279038 7:157765830-157765852 GTGGATGAGTGGATGGATGGAGG - Intronic
1035279104 7:157766116-157766138 ATGGATAAGTAGATGGATGATGG - Intronic
1035279182 7:157766481-157766503 GTGGATCAATGGATGGATGGAGG - Intronic
1035318719 7:158014444-158014466 ATGGATGGGTAGATGGATGGAGG - Intronic
1036289865 8:7477801-7477823 CTGTCTCACTTGAGGGATGGGGG + Intergenic
1036331614 8:7833726-7833748 CTGTCTCACTTGAGGGATGGGGG - Intergenic
1038555020 8:28505176-28505198 CTGGATCAGTAGAGGGATGGAGG - Intronic
1039073230 8:33664920-33664942 TTGTTTCAGTAGAGTGATGGAGG - Intergenic
1040821132 8:51558978-51559000 ATGGATTAGTAGAGGGAAAGAGG + Intronic
1041692608 8:60703750-60703772 CTGGCTCAATAGAGGGAAGGTGG - Intronic
1045481177 8:102593455-102593477 CTGGAGCGGGAGAGGGAGGGGGG + Intergenic
1046582596 8:116111346-116111368 CTAGATCTGTAGAAGGAAGGAGG + Intergenic
1049035869 8:140075448-140075470 CTGGAGGAGGAGAGGGATGTGGG - Intronic
1052750501 9:32484836-32484858 CTGAGCCAGTAGAGGAATGGTGG + Intronic
1053730914 9:41056107-41056129 CTGGAACAGAAGAAGGAGGGCGG - Intergenic
1054697599 9:68375983-68376005 CTGGAACAGAAGAAGGAGGGCGG + Intronic
1055414600 9:76067656-76067678 GTGGATCAGTAGAAGTTTGGGGG + Intronic
1055922862 9:81479806-81479828 CTGGATGAGGAGATGGGTGGAGG + Intergenic
1056885609 9:90440825-90440847 CTGGTTCAGTCTTGGGATGGTGG + Intergenic
1057273295 9:93662776-93662798 GTGGATGGGTAGATGGATGGAGG + Intronic
1057353227 9:94317227-94317249 CTGCATCAGGAGAGGGACTGAGG - Intergenic
1057654523 9:96940364-96940386 CTGCATCAGGAGAGGGACTGAGG + Intronic
1058714740 9:107713605-107713627 GTGGAGGAGTAGAGGGAGGGAGG + Intergenic
1058987387 9:110220832-110220854 CTGGAGAAGTAGTGGGAGGGGGG + Intergenic
1060817774 9:126644388-126644410 CAGGCTCAGAAGAGGGAGGGGGG + Intronic
1060978186 9:127777504-127777526 CTGGGGCAGCAGGGGGATGGGGG - Intronic
1060978205 9:127777554-127777576 CTGGGGCAGCAGAGGGATGGGGG - Intronic
1062137834 9:134939024-134939046 CTGCAGCAGCAGAGGGGTGGGGG - Intergenic
1062281321 9:135753074-135753096 ATGGATGAGTGGATGGATGGAGG + Intronic
1203472940 Un_GL000220v1:124675-124697 AAGGATCAGTAGAGCGATGGTGG - Intergenic
1187320365 X:18232399-18232421 CTGGATCAGTAATATGATGGTGG + Intergenic
1187649671 X:21388678-21388700 CTAGATAAGTAGAGAAATGGAGG + Intronic
1187912111 X:24120594-24120616 CTGGATAATTAGAGGGACAGAGG - Intergenic
1188662213 X:32774671-32774693 TTGGATCATTTGGGGGATGGGGG - Intronic
1188675819 X:32937632-32937654 TTGGATGAGTAGACGAATGGAGG + Intronic
1188820583 X:34770182-34770204 ATGGACCAGTAGAGAGATGAGGG - Intergenic
1191093655 X:56651779-56651801 CTGGTTCAGTAGTGAGAGGGTGG + Intergenic
1192603183 X:72486382-72486404 GTGGAGCAGTAGAGGGAAAGGGG - Intronic
1193882103 X:86936184-86936206 GTGCATCAGTAGTGGCATGGGGG + Intergenic
1196659065 X:118251032-118251054 CTGGATATGTTGAGGGATGTAGG - Intergenic
1197344633 X:125318041-125318063 CTGGAGGAGTAGGGGGATGTAGG - Intergenic
1198717455 X:139573507-139573529 CAGGAGCAGGAGAGTGATGGGGG - Intergenic
1198871595 X:141181394-141181416 CTGGCTAAGAAGGGGGATGGGGG - Intergenic